<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-36370494</id><updated>2012-02-19T01:20:24.821-05:00</updated><category term='Islam'/><category term='Pseudoscience'/><category term='Geology'/><category term='Death Penalty'/><category term='atheism'/><category term='Flying'/><category term='Intelligent Design'/><category term='Astronomy'/><category term='Science'/><category term='Creationism'/><category term='Judaism'/><category term='war'/><category term='Genetics'/><category term='George Bush'/><category term='Natural Selection'/><category term='String Theory'/><category term='Evolution'/><category term='Cosmology'/><category term='Al-Qaeda'/><category term='religion'/><category term='Christianity'/><category term='Reason'/><category term='The Bible'/><category term='Iraq'/><category term='morality'/><title type='text'>The Flying Bagpiper</title><subtitle type='html'>"Faith is the great cop-out, the great excuse to evade the need to think and evaluate evidence. Faith is belief in spite of, even perhaps because of, the lack of evidence." - Richard Dawkins</subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>16</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-36370494.post-3910049772223831590</id><published>2008-08-28T01:59:00.003-04:00</published><updated>2008-08-28T02:03:31.471-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Intelligent Design'/><category scheme='http://www.blogger.com/atom/ns#' term='atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Cosmology'/><category scheme='http://www.blogger.com/atom/ns#' term='String Theory'/><category scheme='http://www.blogger.com/atom/ns#' term='Creationism'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><category scheme='http://www.blogger.com/atom/ns#' term='Natural Selection'/><title type='text'>Response to "5 Questions Every Intelligent Atheist Must Answer"</title><content type='html'>&lt;div align="left"&gt;  &lt;table align="left" border="1" cellspacing="1" width="200"&gt;   &lt;tbody&gt;&lt;tr&gt;    &lt;td&gt;    &lt;p align="justify"&gt;    &lt;img src="http://1.bp.blogspot.com/_BnpxRDVAGaM/SLY-_unS5JI/AAAAAAAAAEM/1TTW3JxGF5o/s1600/aspirin.jpg" border="0" height="200" width="200" /&gt;&lt;/p&gt;    &lt;p&gt;-     Watch the below video, and you might need a few of these&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;  &lt;/tbody&gt;&lt;/table&gt; &lt;/div&gt; &lt;p align="justify"&gt;    I first heard of this video (&lt;a href="http://www.youtube.com/watch?v=cTYe_V2hOZ4"&gt;5  Questions Every Intelligent Atheist Must Answer&lt;/a&gt;) by &lt;a href="http://www.youtube.com/user/philos71"&gt;philos71&lt;/a&gt; from &lt;a href="http://www.youtube.com/user/RabidApe"&gt;RabidApe&lt;/a&gt;'s &lt;a href="http://www.youtube.com/watch?v=I5TS-177BQM"&gt;response&lt;/a&gt; to it.  I  decided to listen to the video first and answer it myself.  At first, the  video looked well put together, and maybe I would even be treated to questions  that would actually pose a challenge and cause me to think.  Fuck was I  wrong.  Instead, I was "treated" to the usual stupid strawman arguments for  creationism, and a big fucking headache.  However, I will still answer  them, and pop a few aspirins.  I've included the time the questions where made in the video in  brackets.&lt;/p&gt; &lt;p align="justify"&gt;    The headache actually begins even before the questions.   Even before a full minute has elapsed (46 seconds to be exact) he claims that  the questions are a problem for your "atheistic belief system."  Oh  Christ.   As has been said by every single atheist I know, there is no such thing as an  "atheistic belief system."  The only belief that all atheists have in  common, is that they lack belief in a god, that's it, and it's not even a common  belief, its a common lack of belief!  Right away, the strawman arguments  begin.&lt;/p&gt; &lt;ol&gt;&lt;li&gt;  &lt;p align="justify"&gt;(1:17) &lt;b&gt;Aren't you using "chance" in the exact same way in which you   accuse Christians of using "God of the Gaps"?&lt;/b&gt; - No.  Not even   fucking close.  It is a regular creationist claim that science evokes   random chance and events for evolution, the big bang, and basically anything   and everything that doesn't agree with the bible.  Of course, science   doesn't use chance to explain anything.  As for cases where science   genuinely doesn't know, we don't answer with "it was chance," we honestly   say we don't know, and then search for the answer,  &lt;/p&gt;&lt;/li&gt;&lt;li&gt;  &lt;p align="justify"&gt;(2:25) &lt;b&gt;Why should there be something instead of nothing?&lt;/b&gt; - This   is really just stupid, and is just the basic argument from design.  He   saying that because we exist, a god must exist.  Needless to say, I   could easily ask the question "Why should a god exist instead of no god?"    Of course I already know the creationists answer to this, a god exists   outside of time, and doesn't have a beginning.  In deed, according to   him "Every intelligent person knows that this world came into existence at   some point in time."  In itself, this is already a fairly narrow   view of reality, as the universe itself could exists outside of time, and   time simple an element of that universe (ie, if you had a box of water, the   water would be dependant on the box, not the other way around).  Also,   and unfortunately for philos71, his statement on what "every intelligent   person knows" is not what most physicists and cosmologists believe.    Yes, the universe as we know it began approximately 13.73 billion years ago&lt;sup&gt;[1]&lt;/sup&gt;.    However, this is not to say that nothing existed before that.  As I   understand, many string theorists believe that our universe was formed to   the collision of two &lt;a href="http://en.wikipedia.org/wiki/Branes"&gt;branes&lt;/a&gt;,   and the "&lt;a href="http://en.wikipedia.org/wiki/Multiverse#M-theory"&gt;multiverse&lt;/a&gt;"   that this happened in has always existed.  In deed the properties of   this universe that philos71 claims are fine-tuned for life may have been set   by the collision itself.  Naturally with an infinite number of branes,   an infinite number of collisions and subsequent universes, naturally some of   them are going to be able to support life.  Also, he talks about how   the Earth itself is fine-tuned for life.  Needless to say, he has this   backwards, life is fine-tuned for the Earth it lives on.  If Earth was   closer to the sun, and life evolved on it, it would evolve to be best   adapted to that hotter Earth, and same idea if the Earth was farther from   the sun.  He even evokes "Moral Order" in the same light (i.e. why have   morals instead of not?).  Which brings him, and unfortunately my   headache, to the next points.  If you haven't started popping aspirins   yet, I suggest you crack open your bottle, you're going to need them for   these:  &lt;/p&gt;&lt;/li&gt;&lt;li&gt;  &lt;p align="justify"&gt;(3:54) &lt;b&gt;Where do you get your morals from?&lt;/b&gt; - Here   he ends up into a huge strawman argument, and the only thing he gets close   to right, is that morals can evolve (although he invokes groups selection to   do it, so ends up quickly dropping the ball).  But were the real idiocy   here is, is that he says that the organism itself has to &lt;i&gt;know&lt;/i&gt; that   self-sacrificing behavior is beneficial to the species, and that because we   didn't know about evolution and genetics till the 19th century, altruistic   behavior couldn't have existed before that (at least without a god).    He even goes as far as to say that animals find it easier to kill opposition   and lack the moral behaviors that we do.  Of course, this isn't even   close to what biologists believe about the evolution of group behaviors such   as &lt;a href="http://en.wikipedia.org/wiki/Reciprocal_altruism"&gt;reciprocal   altruism&lt;/a&gt; (doing good on to others, in the hope that they may do good   unto you later).  As for his claim about animals usually killing   competition, this is outright wrong.  In most cases where a species   lives in a group (like humans and other primates), killing is not only rare,   it is often punished.  There's no active thought in this behavior, it   is pure instinct, and yes, this instinct evolves over time.  In the   game "&lt;a href="http://en.wikipedia.org/wiki/Prisoner%27s_dilemma"&gt;Prisoner's   dilemma&lt;/a&gt;" where two players either have to betray their partner (and get   a large reward, the other jail), or stay silent and help there partner who   hopefully doesn't betray him (and both get a small reward), the best   strategies were ones that were inherently co-operative, namely tit-for-tat   (the basics of reciprocal altruism)&lt;sup&gt;[2]&lt;/sup&gt;.  Indeed, I'd be   interested to hear him explain why social creatures such as monkeys, apes,   lions, whales, etc. exhibit "morals" such as altruism, despite the fact that   they clearly do not believe in god.  Anyone want to bet that he would   invoke "design?"  Now of course, here's where things get really ironic.    He claims that atheists therefore rely on the morals of people of the past   who where moral, and can't look to the future to guide them.  This   coming from a man who follows the teachings of a potentially fictional man   that died nearly 2000 years ago, and who said we should follow the teachings   of a bronze age text written thousands of years before that?  I   honestly don't even know how to answer that its so stupid, so I summarize my   answer for his actual question:  My morals are based on a scientific   world view, which help guide me to do what is best and most helpful to   humankind.  &lt;/p&gt;&lt;/li&gt;&lt;li&gt;  &lt;p align="justify"&gt;(5:22) &lt;b&gt;How did morals evolve?&lt;/b&gt; - This is really   just a rehash of the last question, and I've already answered it, so on to   the last mind-numbing question, or it may be the aspirins that are numbing   my mind right now, I can't tell.  &lt;/p&gt;&lt;/li&gt;&lt;li&gt;  &lt;p align="justify"&gt;(6:19): &lt;b&gt;Can nature generate complex organisms, in the   sense of originating it, when previously there was none?&lt;/b&gt; - Most   definitely yes, and it is done through a process called natural selection.    I have to say, I'm glad I just did a post on simulating natural selection,   as it itself is a pretty good answer to this question. &lt;/p&gt;&lt;/li&gt;&lt;/ol&gt; &lt;p align="justify"&gt;    Wow, these aspirins are making me dizzy.   I think my next blog will be from rehab, although I'm not sure if the rehab is  for non-prescription drug abuse, or the massive loss of brain cells from  watching such a mind-numbingly stupid video.&lt;/p&gt; &lt;p align="center"&gt;&lt;object height="344" width="425"&gt;&lt;param name="movie" value="http://www.youtube.com/v/cTYe_V2hOZ4&amp;amp;hl=en&amp;amp;fs=1"&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;embed src="http://www.youtube.com/v/cTYe_V2hOZ4&amp;amp;hl=en&amp;amp;fs=1" type="application/x-shockwave-flash" allowfullscreen="true" height="344" width="425"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/p&gt; &lt;ol&gt;&lt;li&gt;&lt;b&gt;Universe&lt;/b&gt;. (August 27&lt;sup&gt;th&lt;/sup&gt;, 200). In &lt;i&gt;Wikipedia, The   Free Encyclopedia&lt;/i&gt;. Retrieved August 28&lt;sup&gt;th&lt;/sup&gt;, 2008 from  &lt;a href="http://en.wikipedia.org/wiki/Universe"&gt;  http://en.wikipedia.org/wiki/Universe&lt;/a&gt;&lt;/li&gt;&lt;li&gt;&lt;b&gt;Dawkins, Richard&lt;/b&gt;. (2006) &lt;i&gt;The Selfish Gene&lt;/i&gt;, 30&lt;sup&gt;th&lt;/sup&gt;   anniversary edition.  Oxford University Press.  ISBN   978-0-19-929115-1&lt;/li&gt;&lt;/ol&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-3910049772223831590?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/3910049772223831590/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=3910049772223831590' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/3910049772223831590'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/3910049772223831590'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2008/08/response-to-5-questions-every.html' title='Response to &quot;5 Questions Every Intelligent Atheist Must Answer&quot;'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/_BnpxRDVAGaM/SLY-_unS5JI/AAAAAAAAAEM/1TTW3JxGF5o/s72-c/aspirin.jpg' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-47450715074251709</id><published>2008-08-25T01:07:00.008-04:00</published><updated>2008-08-25T01:43:14.448-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Genetics'/><category scheme='http://www.blogger.com/atom/ns#' term='Natural Selection'/><title type='text'>Simulating Natural Selection</title><content type='html'>&lt;p align="justify"&gt;&lt;a href="http://4.bp.blogspot.com/_BnpxRDVAGaM/SLJABkhtEeI/AAAAAAAAAC0/mvT89OW2Zvw/s1600/DOTSscreenshot.jpg"&gt;&lt;img src="http://4.bp.blogspot.com/_BnpxRDVAGaM/SLJABwMAfzI/AAAAAAAAAC8/-pYhldDqcRw/s1600/DOTSscreenshot_sm.jpg" align="left" border="0" height="185" width="300" /&gt;&lt;/a&gt;    Needless to say, but this post has been a long time coming.  Shortly after my last post, I started working on a computer program that would simulate natural selection using organisms whose properties where based on its genome as opposed to simply programmed properties.  Also, I wanted to make sure that the selection process on the organisms where as close to pure natural selection as possible, while staying away from artificial selection.  In other words, I wanted to defining factor to be based on reproductive success, as opposed to a pre-programmed goal (such as fastest runner, etc.).&lt;/p&gt; &lt;p align="justify"&gt;    At first, the programming was going great, I had spent quite a few months working on it, and I had a working program and was beginning to compile samples and results.  That's when everything went to hell.  A seemingly insignificant crack on the side of my laptop eventually split the screen from the main body of laptop, which broke the cord between the screen and the main body, and sent a short circuit to the hard drive, destroying all the information contained.  Not only did I loose the program, I also lost almost a years work in other programs, and 3D models (for a &lt;a href="http://www.ioss.ca/"&gt;space station&lt;/a&gt; I was building with &lt;a href="http://orbit.medphys.ucl.ac.uk/orbit.html"&gt;Orbiter&lt;/a&gt;).&lt;/p&gt; &lt;p align="justify"&gt;    Needless to say, loosing months and months of data, programs, and 3D models rather killed my enthusiasm.  Eventually however, I did get back to re-creating the program.  The first incarnation was made mostly at my work while I worked on the night shift, and one of my colleagues would always ask my if I was "playing with my dots" (the organisms in the program are represented by little squares).  So when I started my new program, I decided to officially name it DOTS (&lt;u&gt;D&lt;/u&gt;NA &lt;u&gt;O&lt;/u&gt;ver &lt;u&gt;T&lt;/u&gt;ime &lt;u&gt;S&lt;/u&gt;imulator).  It's not entirely the most accurate title, namely that the program also simulates RNA as well as DNA, in fact, when the program was first written, it only simulated RNA.&lt;/p&gt; &lt;h2 align="justify"&gt;Introduction&lt;/h2&gt; &lt;h3 align="justify"&gt;Genes&lt;/h3&gt; &lt;div align="left"&gt;  &lt;table align="left" cellpadding="0" cellspacing="0" width="480"&gt;   &lt;tbody&gt;&lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Alanine/A&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;GCT, GCC, GCA, GCG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Leucine/L&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TTA, TTG, CTT, CTC, CTA, CTG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Arginine/R&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;CGT, CGC, CGA, CGG, AGA, AGG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Lysine/K&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;AAA, AAG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Asparagine/N&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;AAT, AAC&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Methionine/M&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;ATG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Aspartic acid/D&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;GAT, GAC&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Phenylalanine/F&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TTT, TTC&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Cysteine/C&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TGT, TGC&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Proline/P&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;CCT, CCC, CCA, CCG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Glutamine/Q&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;CAA, CAG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Serine/S&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TCT, TCC, TCA, TCG, AGT, AGC&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Glutamic acid/E&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;GAA, GAG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Threonine/T&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;ACT, ACC, ACA, ACG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Glycine/G&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;GGT, GGC, GGA, GGG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Tryptophan/W&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TGG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Histidine/H&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;CAT, CAC&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Tyrosine/Y&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TAT, TAC&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Isoleucine/I&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;ATT, ATC, ATA&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    Valine/V&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;GTT, GTC, GTA, GTG&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;   &lt;tr&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    START/M&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;ATG&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="right"&gt;    &lt;p style="line-height: normal; margin-bottom: 0.0001pt;"&gt;&lt;b&gt;    STOP/*&lt;/b&gt;&lt;/p&gt;&lt;/td&gt;    &lt;td style="border: 1pt solid windowtext; padding: 0.75pt;" align="left" width="120"&gt;    &lt;p style="margin-bottom: 0.0001pt; line-height: normal;"&gt;TAG, TGA, TAA&lt;/p&gt;&lt;/td&gt;   &lt;/tr&gt;  &lt;/tbody&gt;&lt;/table&gt; &lt;/div&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    When the program is started, a list of genes is created.  The code used for the genes is the same as used in all eukaryotic organisms&lt;sup&gt;[1]&lt;/sup&gt;.  RNA organisms in the program all use the same code, the only difference is that the nucleotide for Thymine (T) is written as a Uracil (U) instead, however this has no major effect on the coding itself.  All genes are composed of an amino acid for Methionine (the start codon), and a stop marker.  An example of a gene would be "MDDTWRKPRstop".&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    However since many of these amino acids can be expressed in different ways, there are many different strings of nucleotides that can code for those amino acids, for example:
 &lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M   D   D      T   W   R   K   P   R      *&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATG GAC GAC ACA TGG AGG AAG CCG    CGT TGA&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATG GAC GAT ACC TGG AGG AAG CCA    CGA TAA&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATG GAT GAC ACT TGG CGC AAA CCT    CGC TAG&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p align="justify"&gt;    Each gene that an organism has subtracts energy from the organism, based on the length of the gene.  The longer the gene, the more energy it uses.  At present, there are 9 different types of genes programmed.  If a gene appears in an organism that doesn't appear as any of the functional gene lists, it will still subtract energy while providing no other effect on the organism, and is labeled as a Pseudogene.  The different functional types of genes are:&lt;/p&gt; &lt;p align="justify"&gt;    &lt;b&gt;Herbivore Genes&lt;/b&gt;:  These extract energy from the environment.  The amount of energy available to each organism is based on a number of factors.  Firstly, is the maximum amount of energy the herbivore gene can extract.  Secondly, the amount of surrounding squares that are unoccupied.  Only squares that have no organisms (other then its own) can provide energy, so the more open squares, the more energy available.  Conversely, the fewer organisms that surround each of those open squares allows for the open square to provide more energy itself.  Lastly, there is a maximum amount of energy that each square can provide.  For example, if the maximum amount available is set to 500, and the gene's maximum available energy was 700 (or the total of all the herbivore genes), then even if every square was open, and every square around those were open, then the organism could still only extract 500 from the environment.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Asexual Reproduction Genes&lt;/b&gt;:  These allow an organism to reproduce independently of a mate, and are the most basic (and currently only) form of reproduction creating a clone of the parent organism.  The more Asexual Reproduction Genes an organism has, the more offspring it can produce at a time (for example, if it has 3 genes, then it can produce 3 offspring at a time, assuming that many open squares are available).  If an organism lacks an Asexual Reproduction Gene, then it will be sterile, and unable to reproduce.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Attack Genes&lt;/b&gt;:   If there are other organisms surrounding the organism with an attack gene, it will randomly select one and try to kill it.  Each Attack Gene that an organism has, adds one attack point to it.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Defense Genes&lt;/b&gt;:  Each defense genes that an organism has, adds one defense point to it.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Carnivore Genes&lt;/b&gt;:  These genes allow an organism to extract energy from any other organisms that it kills.  The amount of energy extracted from a kill is based on the length of the prey's genome, and the efficiency of the gene.  The more efficient the gene, or the longer the prey's genome, the more energy extracted.  The amount available also depends on if the organism it is consuming is a herbivore (full efficiency), and omnivore (half efficiency), or another carnivore (fifth efficiency).  If an organism has more then one carnivore gene, then the organism's total carnivore efficiency is an average of the genes efficiency.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Altruistic Genes&lt;/b&gt;:  Organisms that contain one of these genes are stopped from attacking other organisms of the same species.  Whether or not an organism is deemed as the same species, is based on how similar its genomes are.  For example, if an organism shared 95% of its DNA in common with its prey, and its Altruistic Gene was set at 6%, then it would consider it the same species and would not attack.  However, if the same organism had an Altruistic Gene set at just 4%, then it would deem the prey as another species, and continue its attack.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Transcription Error Protection Genes (TEP Genes)&lt;/b&gt;:  These genes control the amount of error during transcription when an organism reproduces.  It a TEP Gene has a value of 1%, then there is a 1% chance every time a nucleotide is transcribed during reproduction, that a nucleotide will be duplicated, skipped, or changed.  If an organism lacks a TEP Gene, then the chances of error sky-rocket, rendering it almost infertile, as any offspring of its will likely lack any functioning genes due to widespread error.  If an organism contains multiple TEP genes, then the organism's Transcription Error will be an average of its TEP genes.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Offspring Energy Transfer Genes (OEP Genes)&lt;/b&gt;:  Organisms containing this gene, pass on a percentage of its energy to its offspring when it reproduces.  The percentage of its energy that it passes on differs between each OEP Gene, and if an organism has more then one, then it averages the percentages between the genes.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Movement Genes&lt;/b&gt;:  These genes give an organism the ability to move to an adjacent square.  In herbivores, it will move the organism to the most open square available, in carnivores it moves it to an open square that is adjacent to other organisms.  The more Movement Genes an organism has, the less energy is needed during movement.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    Genes do not have to match the genes in the lists 100%.  Genes that match only partially (down to a certain percentage, the default is a minimum 60% match), work with reduced effectiveness.  In Herbivore Genes for example, a partially match reduces the amount of herbivore energy that the gene can extract from the environment.  For Carnivore Genes, it reduces the genes carnivore efficiency.  Another effect of a gene needing to be only partially matched is that a gene may match (or partially match) many different genes, and therefore a single gene may take on multiple abilities.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    Below is an example of an organism and the genes it contains.  It contains 1474 nucleotides (or 737 base pairs) contains both partial genes, a short pseudogene, and was born after 2442 turns:
 &lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   TTAGGGAAAAAAACCCCGGGATAACCAGGTCCAAAAGACTTTTTTCCCTC
  AATCCCTTTTTTTGGGGCCCTATTGGTCCAGGTTTTCTGAAAAAAGGGAG&lt;/span&gt;&lt;/span&gt;&lt;p&gt; &lt;span style="font-size:85%;"&gt;  &lt;span style="font-family:Lucida Console;"&gt;   CAAACTATTTCACTCCCTCCATTTTAGGGTATTTTTTGGGGGACGCCTCA
  GTTT&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#c800c8;"&gt;&lt;u&gt;GATAAAGTGAGGGAGGTA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;AAATCCCATAAAAAACCCCCTGCGGAGT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AACAAGGGGAAGTGGAGCCCCGGAGGATACCCGCCCTCAGTGGAAAGC&lt;/span&gt;&lt;/span&gt;&lt;span style="font-size:85%;color:#00b400;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;AT
  &lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   TTGTTCCCCTTCACCTCGGGGCCTCCTATGGGCGGG&lt;/span&gt;&lt;span style="font-size:85%;color:#c800c8;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;AGTCACCTTTCGTA&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;color:#c800c8;"&gt;&lt;u&gt;  &lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;color:#00b400;"&gt;&lt;u&gt;   &lt;/u&gt;&lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;color:#00b400;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;GCATTTTTTTCACTAG&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;CCGGTCCTGGTGGGCAACGAAAAACCGAGCTTGG
  &lt;/span&gt;&lt;/span&gt;&lt;span style="font-size:85%;color:#c800c8;"&gt;&lt;u&gt;   &lt;span style="font-family:Lucida Console;"&gt;CGTA&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;AAAAAAGTGATCGGCCAGGACCACCCGTTGCTTTTTGGCTCGAACC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   CTAAACCGGACAATAACTTCCGCGGGTTTTGGGGCTCCCCCAAAGGTGCC
  GATTTGGCCTGTTATTGAAGGCGCCCAAAACCCCGAGGGGGTTTCCACGG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GAGGGGATTTTGGGGCGGCGAAAAAGAGTTTCGCCGTAGAACCCCCAAGG
  CTCCCCTAAAACCCCGCCGCTTTTTCTCAAAGCGGCATCTTGGGGGTTCC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GAGGCGCAAGGGCCAATTTCACGGGAGGTATAGGTTCACTTCCATAGACA
  CTCCGCGTTCCCGGTTAAAGTGCCCTCCATATCCA&lt;/span&gt;&lt;/span&gt;&lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;AGTGAAGGTATCTGT&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;  &lt;/u&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;CATAAACGTTTTCCCAAGTACCCCCTAAAGGGCCTCCAAAGAAAGGGGGA
  &lt;/span&gt;&lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;GTA&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;TTTGCAAAAGGGTTCATGGGGGATTTCCCGGAGGTTTCTTTCCCCCT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AGCTCCCGTAAAAAACAAAACGTTGGTCGGGGGGGTCTTTTTGAGGGGGA
  TCGAGGGCATTTTTTGTTTTGCAACCAGCCCCCCCAGAAAAACTCCCCCT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GCCGGGTCCGGTGGTAGTCCTAAGGTGATAGGGATTTGTTGGCGGGGTGG
  CGGCCCAGGCCACCATCAGGATTCCACTATCCCTAAACAACCGCCCCACC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   TTTTTCTGCTATTAAAACAAATTTTTTACTCCATTGGGCGCGCCCCAGCC
  AAAAAGACGATAATTTTGTTTAAAA&lt;u&gt;AATGAGGTA&lt;/u&gt;ACCCGCGCGGGGTCGG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;GTTGTTTCCTCGCCCA&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#00b400;"&gt;&lt;u&gt;ATGTTTGCGGTTCCTTAA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;CCCCAGTGGTCGTAAC
  CAACAAAGGAGCGGGTTACAAACGCCAAGGAATTGGGGTCACCAGCATTG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   CCCCGCTTCGGGGCGCAGCCCTTCCGAAACCACCAACCAAAGCTTTAATA
  GGGGCGAAGCCCCGCGTCGGGAAGGCTTTGGTGGTTGGTTTCGAAATTAT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GCTCGAATCACAGTTTCCCTTTGGGGGGGCGGGGGGGCCCCAGGGTAAGA
  CGAGCTTAGTGTCAAAGGGAAACCCCCCCGCCCCCCCGGGGTCCCATTCT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;AAACGGGGGGGGAAGCCCCTGTCCGGACAAAACTGTA
  TTTGCCCCCCCCTTCGGGGACAGGCCTGTTTTGACAT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p&gt;    The genes contained in the organism are:&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="1"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td align="right" width="298"&gt;Herbivore Gene 1 100%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  H     F  F  H  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCATTTTTTTCACTAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt;Herbivore Gene 13 80%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  F     A  V  P  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGTTTGCGGTTCCTTAA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt;Pseudogene&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  E  *&lt;/span&gt;&lt;p&gt;   &lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGGAGTAA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt;TEP Gene 1 100%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  C  L  W     K  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGTGTCTATGGAAGTGA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt;Herbivore Gene 1 80% +    Asexual Reproduction Gene 1 60%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  H  A  F     H  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCATGCTTTCCACTGA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" width="298"&gt;Herbivore Gene 13 60% +    Asexual Reproduction Gene 26 80%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  E  G  V     K  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGGAGGGAGTGAAATAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;h3&gt;Organisms&lt;/h3&gt; &lt;p align="justify"&gt;    After the list of genes are created, the program then  creates the organisms.  It starts with a creating a genome for a master  organism, and then duplicates it across the grid.  The grid the organisms  live on consists of 50 rows and 100 columns, totaling 5000 squares.  The  starting genome consists of a Herbivore Gene, TEP Gene, an Asexual Reproduction  Gene, and "junk DNA" spread out between and around the genes randomly.   When the junk DNA is made, the letters "ATG" and "CAT" (the reverse synonym for  ATG) are prevented from appearing so as no pseudogenes appear that would  interfere with the starting three 3 genes, however if one of the working genes  contain CAT in it, then a pseudogene will appear on the opposite side of the  gene.  The 3 active genes can appear in any order, and on other the 5' (5  prime, read left-to-right) or 3' (3 prime, read right-to-left) side of the genome.  Below is an example of a first  generation organism, it contains 1308 nucleotides (654 base pairs) and is the  ancestor of the organism shown above:&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   ATTTAGAGCGAACCGTGCGGCCGCTATTGATCAAGTTTCTGCTAACAGCG
  TAAATCTCGCTTGGCACGCCGGCGATAACTAGTTCAAAGACGATTGTCGC&lt;/span&gt;&lt;/span&gt;&lt;p&gt; &lt;span style="font-size:85%;"&gt;  &lt;span style="font-family:Lucida Console;"&gt;   AACTAAATCAGTTGACCTCTACAACCGGAACAGCCGAAGGAAGGAGGTGC
  TTGATTTAGTCAACTGGA&lt;/span&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;GATGTTGGCCTTGTCGGCTTCCTTCCTCCACG&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;&lt;u&gt;  &lt;/u&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;TTCTTTGCCGACTCAGTCGAAACGA&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#00b400;"&gt;&lt;u&gt;ATGCATTTCTTTCACTGA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;GTCTATC
  &lt;u&gt;AAGAAACGGCTGAGTCAGCTTTGCTTACGTA&lt;/u&gt;AAGAAAGTGACTCAGATAG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   CTCTCAAGAAAGAACGAAGCACACTCGGCGTACTGACAGCAGGCAACAGG
  GAGAGTTCTTTCTTGCTTCGTGTGAGCCGCATGACTGTCGTCCGTTGTCC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   CACTCCCCAAAAGTAGGGGTTGACACTGTGAGGAATAACTGCCTTGGCTC
  GTGAGGGGTTTTCATCCCCAACTGTGACACTCCTTATTGACGGAACCGAG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GGTTAGACGACGCAACCCCAAAAAGTGCCCAATTTAGATTACTTCCATAG
  CCAATCTGCTGCGTTGGGGTTTTTCACGGGTTAAATCT&lt;/span&gt;&lt;/span&gt;&lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;AATGAAGGTATC&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;  &lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   ACACATAAGAACCCGGAATTAGTCTCTTCCTAGGAAAAGGTCTATTTGTA
  &lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#006464;"&gt;&lt;u&gt;   TGTGTA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;TTCTTGGGCCTTAATCAGAGAAGGATCCTTTTCCAGATAAACAT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   TTAGATCAACTAGAGTTGCAGAGGCTCAGTCGCGAAACGCTCAGGGAGTC
  AATCTAGTTGATCTCAACGTCTCCGAGTCAGCGCTTTGCGAGTCCCTCAG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AGACTACAATACGTTATCTGTTGTAGAGCTTTTGTAATACCGTTGGTACC
  TCTGATGTTATGCAATAGACAACATCTCGAAAACATTATGGCAACCATGG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;ACAAGTTCGGCTGTGCGCGTCGAGGAATCAA&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#c800c8;"&gt;&lt;u&gt;ATGAGCGCGTTTGCTTGA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;C
  TGTTCAAGCCGACACGCGCAGCTCCTTAGTTTACTCGCGCAAACGAACTG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GGGCACAGTAAACTTCCCACCCAATAGAGAAGGTGATATCTAGCGACCTA
  CCCGTGTCATTTGAAGGGTGGGTTATCTCTTCCACTATAGATCGCTGGAT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   ATCAGCCACGTCCGATCCACGTACGTGGCGTCCTCGCGTTCGCCAGTCTT
  TAGTCGGTGCAGGCTAGGTGCATGCACCGCAGGAGCGCAAGCGGTCAGAA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AGTGTTAAGAGAGAGTCAAGAAGTAAGTGCCTGCGACGGATATTCCGCCA
  TCACAATTCTCTCTCAGTTCTTCATTCACGGACGCTGCCTATAAGGCGGT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;ATAG
  TATC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p&gt;    The genes contained in the organism are:&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="1"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td align="right"&gt;Herbivore Gene 100%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  H  F  F     H  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCATTTCTTTCACTGA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Asexual Reproduction Gene 100%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  S  A  F     A  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGAGCGCGTTTGCTTGA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;TEP Gene 1 100%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  C  L  W     K  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGTGTCTATGGAAGTAA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Pseudogene&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  H  S  F     R  L  S  R  Q  R  S  T  S     F  L  R  L  F  R  L  *&lt;/span&gt;&lt;p&gt;   &lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCATTCGTTTCGACTGAGTCGGCAAAGAAGCACCTCCTTCCTTCGGCTGTTCCGGTTGTAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p align="justify"&gt;    Virtually all of the organisms features and properties are  encoded by its genome and the genes therein.  The only properties that are  coded separately are the organisms Life Expectancy (when it dies of old age),  and its Age of Maturity (the age it can begin to reproduce).  Each of these  provide various advantages and disadvantages.  The later the Life  Expectancy, the more chances an organism will be able to reproduce, but the more  energy the organism will need to reproduce.  The earlier an organism  matures, the sooner it can reproduce, however the later it matures, its attack  points, defense points, and OET efficiency goes up.&lt;/p&gt; &lt;h3 align="justify"&gt;Asexual Reproduction&lt;/h3&gt; &lt;p align="justify"&gt;    When an organism reproduces, it transcribes the nucleotides of  the 5' strand, and then mirrors it for the 3' side.  Every time a  transcription is made, there is a chance (as dictated by the organism's TEP  genes) for error.  The nucleotide may be altered, omitted, or be copied  twice.  Each type of error has an equal chance of occurring.  Life  Expectancy and Age of Maturity also can change during reproduction.  Life  Expectancy and Age of Maturity, separately, can either increase, decrease, or  stay the same with equal chance of each happening.  Below are the first 50  nucleotides of the 5' side of a first generation organism, and three 2nd  generation offspring.&lt;/p&gt; &lt;table border="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td align="right"&gt;First Generation&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   CACTATCCTCAGCTAACGATCCCACTATACTCTCACCAAGATTTTTAAGG&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;9&lt;sup&gt;th&lt;/sup&gt; point substitution&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   CACTATCCACAGCTAACGATCCCACTATACTCTCACCAAGATTTTTAAGG&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;29&lt;sup&gt;th&lt;/sup&gt; point deletion&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   CACTATCCTCAGCTAACGATCCCACTATCTCTCACCAAGATTTTTAAGGA&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;37&lt;sup&gt;th&lt;/sup&gt; point duplication&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;   CACTATCCTCAGCTAACGATCCCACTATACTCTCACCCAAGATTTTTAAG&lt;/span&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;h3&gt;Combat&lt;/h3&gt; &lt;p align="justify"&gt;    If an organism contains at least 1 attack gene, it may  attack an organism in an adjacent square (either horizontally, vertically or  diagonally).  In the program, the organism attacking is known as the  predator, and the organism being attacked becomes the prey.  If the prey  has attack genes of its own, then the organisms attack properties are matched up  against each other.  If one organism's attack points are higher then the  other, it does not guarantee victory.  Each organisms attack points are  multiplied by separate random numbers.  Therefore a predator with an attack  point value of 2 attacking a prey with an attack point value of 1 will be twice  as likely to win, but not automatically guaranteed.&lt;/p&gt; &lt;p align="justify"&gt;    After the initial attack phase, comes an attack/defense  phase.  If the prey wins the attack phase of combat, then the roles in the  attack/defense phase are reversed.  The predator's attack points come up  against the prey's defense points in the same style as the attack phase.   The predator's attack points are multiplied by a random number, and the prey's  defense points are multiplied by a separate random number, with the higher  number winning.  If the predator wins, then the prey is killed (and  consumed if the predator is a carnivore/omnivore).  If the predator loses,  and the prey's defense is successful, then both sides survive.  Both  attacking and defending consume energy.  If an organism's energy falls  below zero as a result of the combat, then the organism dies.&lt;/p&gt; &lt;h2&gt;Results&lt;/h2&gt; &lt;h3&gt;Speciation&lt;/h3&gt; &lt;div align="justify"&gt; &lt;table border="0" cellspacing="1"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td align="justify" valign="top"&gt;   &lt;div align="left"&gt;    &lt;table align="left" border="0"&gt;     &lt;tbody&gt;&lt;tr&gt;      &lt;td&gt;      &lt;a href="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLI-ar-fLaI/AAAAAAAAABk/o8WeKXSNxsY/s1600-h/Chart1.jpg"&gt;   &lt;img src="http://1.bp.blogspot.com/_BnpxRDVAGaM/SLI-a3p96BI/AAAAAAAAABs/JjmkADvRRIU/s1600/Chart1_sm.jpg" border="0" height="200" width="400" /&gt;&lt;/a&gt;&lt;p&gt;      &lt;span style="font-size:78%;"&gt;-output7.dfx&lt;/span&gt;&lt;/p&gt;      &lt;p&gt;      &lt;a href="http://4.bp.blogspot.com/_BnpxRDVAGaM/SLI_Uc3uTTI/AAAAAAAAACU/bDf1bOj-Td8/s1600/Chart4.jpg"&gt;      &lt;img src="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLI_UtObBrI/AAAAAAAAACc/Qgez83BjBQg/s1600/Chart4_sm.jpg" border="0" height="200" width="400" /&gt;&lt;/a&gt;&lt;/p&gt;&lt;p&gt;      &lt;span style="font-size:78%;"&gt;-output9.dfx&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;     &lt;/tr&gt;    &lt;/tbody&gt;&lt;/table&gt;   &lt;/div&gt;     As the adjacent graph shows, that despite the fact that the    scenario begins with just a single species, diversity increases rapidly    and then fluctuates between 30 and 35 percent (with default TEP Genes    set at 1%).  The drop at the end is the    result of a new gene evolving that incorporated an Attack Gene, a    Asexual Reproduction Gene, and an Altruistic Gene, along with a slightly    more efficient TEP Gene.  This drop is typical when an organism    evolves that has significant advantages over other organisms, and    quickly replace the organisms without the advantage.&lt;p&gt;       In scenarios where a TEP gene emerges that is more effective then the    starting one, diversity drops as the organisms containing the more    efficient TEP gene quickly replaces those without (since their offspring    are more likely to survive).  Once they become the dominate group,    new species take longer to evolve (due to less mutations each    generation), those keeping the diversity down.  For example, the    scenario in output9.dfx, the organisms don't even reach 20% before a    more efficient TEP Gene emerges.  The average chance of    transcription error drops down to 0.236%, however since this includes    organisms lacking a TEP Gene (therefore having a transcription error of    20%), the actual efficiency of the TEP Gene is even higher then that    (error rate of about 0.025%).  The error protection of the gene is    so powerful, that once the organisms with the gene takeover, the genetic    diversity drops down to 0% (all organisms are the same species).     Evolution still occurs, however the rate of change becomes very slow,    and diversity remains low.&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;/div&gt; &lt;h3&gt;Emergent Behavior and Phenomena&lt;/h3&gt; &lt;p align="justify"&gt;    Along with the reproduction behaviors and combat behaviors  programmed into the organisms by their genes, their are a few "emergent"  behaviors that appear that result from the interactions between organisms, that  are not coded in.&lt;/p&gt; &lt;p align="justify"&gt;    &lt;b&gt;Base-pair Repetition&lt;/b&gt;: After a  number of generations, it becomes apparent that many base-pair sequences begin  to repeat themselves.  In the two example organisms above, the first  generation organism contains a total of 27 repetitions greater then 3, the  longest of which was a sequence that lasted 5 spaces, and 6 sequences lasting 4  squares.  While the organism from Turn #2442 contains a total of 85  repetitions greater then 3, the longest sequence lasting 8 spaces.  The  purpose of the repetitions seems to work as a safeguard against the formation of  unwanted pseudogenes by stopping the formation of ATG sites.  Due to the  repetitions, potential sites for an ATG codons to appear (doublets of "AT" or  "TG") decrease.  If the first generation organism there are 103 possible  sites for a single-point mutation to create an ATG codon, whereas the 2442 Turn  organism contains just 85 sites, despite being 13% longer then the first  generation organism.&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;   &lt;div align="left"&gt;    &lt;table align="left" border="1" cellspacing="1"&gt;     &lt;tbody&gt;&lt;tr&gt;      &lt;td&gt;&lt;span style="font-size:85%;"&gt;      &lt;a href="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLJABweyJ8I/AAAAAAAAADE/KZFbBagI-xY/s1600/World1.jpg"&gt;      &lt;img src="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLJACBbVU7I/AAAAAAAAADM/SJR847bO754/s1600/World1_sm.jpg" border="0" height="150" width="300" /&gt;&lt;/a&gt;&lt;/span&gt;&lt;p&gt;      &lt;span style="font-size:85%;"&gt;      -World of organisms containing movement genes&lt;/span&gt;&lt;/p&gt;      &lt;p&gt;      &lt;span style="font-size:85%;"&gt;      &lt;a href="http://4.bp.blogspot.com/_BnpxRDVAGaM/SLJACBevX0I/AAAAAAAAADU/Tz5_11GHdDE/s1600/World2.jpg"&gt;      &lt;img src="http://3.bp.blogspot.com/_BnpxRDVAGaM/SLJAs_d71-I/AAAAAAAAAD0/RPpeOd5cpRI/s1600/World2_sm.jpg" border="0" height="150" width="300" /&gt;&lt;/a&gt;&lt;/span&gt;&lt;/p&gt;&lt;p&gt;      &lt;span style="font-size:85%;"&gt;      -World of organisms lacking movement genes&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;     &lt;/tr&gt;    &lt;/tbody&gt;&lt;/table&gt;&lt;/div&gt;   &lt;p align="justify"&gt;    &lt;b&gt;Pack/Anti-Pack Formation&lt;/b&gt;:      To the right is two screenshots of organisms after about 150 turns.      In the top screenshot, the world started out with organisms     containing Movement Genes.  In the bottom screenshot, the     organisms started without them.  In the world populated by     organisms containing Movement genes, the organisms spread out,     forming a checkerboard pattern, however when they can no longer     spread out, they begin to form into columns and files, forming     patterns similar to that of coral.  The emergent behavior is     due simply to each organism looking to find the most open space     possible.  When there is enough space for each organism to have     completely open adjacent squares, they form the checkerboard     pattern, otherwise, they form the coral shape pattern.&lt;/p&gt;   &lt;p align="justify"&gt;    In scenarios where the     organisms lack movement genes, the organisms do not spread out, and     simple stay near other members of there species, former scattered     clumps of organisms.  When the clumps become too big and the     organisms in the center can no longer provide energy for themselves     (or can no longer reproduce), they die off and the clumps break     apart into smaller clumps.&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p align="justify"&gt;    &lt;b&gt;Multiple Partial Genes&lt;/b&gt;:  Along  with base-pair repetition, another emergent property in the DNA of the organisms  is the tendency for genes to evolve to make multiple partial matches, as opposed  to a single 100% match.  This is caused by the fact it is easier to modify  existing genes then it is to create new ones.  Below is an example of an omnivore that evolved  after 1102 turns, and contains 665 base-pairs (1330 nucleotides), where most of  its functioning genes have evolved towards incorporating multiple gene types as  opposed to evolving genes that match 100%.  The long Pseudogene at the end  of the 3' side does not actually contain a stop codon, instead stopping only  because it has hit the end of the genome:&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AGGTCCGGTCTAAATTAACTTTTTTCCTACCCCTTATTAAGGAAAAACCC
  &lt;/span&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;   TCCAGGCCAGATTTAATTGAAAAAAGGATGGGGAATAATTCCTTTTTGGG&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;p&gt; &lt;span style="font-size:85%;"&gt;  &lt;span style="font-family:Lucida Console;"&gt;   CTCCCCAAGGAGGTGGCCTTATTAATCGGGGGGCTGTACATTTTACAAAT
  &lt;/span&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;   GAGGGGTTCCTCCACCGGAATAATTAGCCCCCCGACATGTAAAATGTTTA&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;&lt;u&gt;  &lt;/u&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;AATAAAAAAACCCGTGTGC&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#00b400;"&gt;&lt;u&gt;ATGGAACCCTTAACTTAA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;"&gt;&lt;span style="font-size:85%;"&gt;AGTGTTCCGGAAA
  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;u&gt;TTATTTTTTTGGGCACACGTA&lt;/u&gt;CCTTGGGAATTGAATTTCACAAGGCCTTT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:78%;"&gt;  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AGCGGCTGAAGCTATTATATACCTTCAGGAGCCTCGAATAAATCTTAACT
  TCGCCGACTTCGATAATATATGGAAGTCCTCGGAGCTTATTTAGAATTGA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GTTGGAGGTTTCTACGGAAAGAAATCAGCCGTTTGTATTCAAATACGTAT
  CAACCTCCAAAGATGCCTTTCTTTAGTCGGCAAACATAAGTTTATGCATA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;TTTAA&lt;u&gt;ATGCTTTACTAG&lt;/u&gt;AAGAAACCACGGGGCCGAAACGCGCCCTTTTTT
  AAATTTACGAAATGATCTTCTTTGGTGCCCCGGCTTTGCGCGGGAAAAAA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;AACG&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;"&gt;&lt;span style="font-size:85%;color:#c800c8;"&gt;&lt;u&gt;ATGCGGAGAGCTCGCTAG&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;AAAA&lt;/span&gt;&lt;span style="font-size:85%;color:#c800c8;"&gt;&lt;u&gt;ATGCAGAAGAGGGCTTAA&lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;GCCGGA
  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;TTGCTACGCCTCTCGAGCGATCTTTTTACGTCTTCTCCCGAATTCGGCCT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:78%;"&gt;  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AAATAGACGGCTGAAACGGCTCGGAAGTCTTATAGGTTTCAACTCTACTG
  TTTATCTGCCGACTTTGCCGAGCCTTCAGAATATCCAAAGTTGAGATGAC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GAGCAGAGCCACTCCCCCGAGGTATAAAAGTTTCTTGAAAGACCACCCTG
  CTCGTCTCGGTGAGGGGGCTCCATATTTTCAAAGAACTTTCTGGTGGGAC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;TTCACCGAAGTCTGGGTTACAAGTTTATATCTTA&lt;/span&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;font-size:85%;color:#006464;"&gt;&lt;u&gt;ATGCCTTGTCCGCAGT
  &lt;/u&gt;&lt;/span&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   AAGTGGCTTCAGACCCAATGTTCAAATATAGAATTACGGAACAGGCGTCA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;   &lt;/u&gt;&lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;color:#006464;"&gt;&lt;u&gt;&lt;span style="font-family:Lucida Console;"&gt;AG&lt;/span&gt;&lt;/u&gt;&lt;/span&gt;&lt;span style="font-family:Lucida Console;"&gt;&lt;span style="font-size:85%;"&gt;GGCTTTACACACAAACGGTAAACAGCGGGAATTAAAATTACCCCCCCG
  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;TCCCGAAATGTGTGTTTGCCATTTGTCGCCCTTAATTTTAATGGGGGGGC&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:78%;"&gt;  &lt;/span&gt;&lt;span style="font-size:85%;"&gt;   &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   GAAAAAATTTTTATTGGGACCCCCTTCAGACGGCGGCTACGTTTTTCTTT
  CTTTTTTAAAAATAACCCTGGGGGAAGTCTGCCGCCGATGCAAAAAGAAA&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;   TGGTTAAAACGGCTTAGAGTACAAATCGCCTTTTGGCGAAAGCAGGACCC
  ACCAATTTTGCCGAATCTCATGTTTAGCGGAAAACCGCTTTCGTCCTGGG&lt;/span&gt;&lt;/span&gt;&lt;/p&gt; &lt;span style="font-size:85%;"&gt;  &lt;/span&gt;&lt;p&gt;&lt;span style="font-size:85%;"&gt;&lt;span style="font-family:Lucida Console;"&gt;GTAAAACCCCTGTTA
  CATTTTGGGGACAAT&lt;/span&gt;&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p&gt;    The genes contained in the organism are:&lt;/p&gt; &lt;table border="0" cellpadding="0" cellspacing="1"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td align="right"&gt;Herbivore Gene 33 60%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  E  P  L     T  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGGAACCCTTAACTTAA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Pseudogene&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  L     Y  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCTTTACTAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Herbivore Gene 37 60% + Carnivore Gene    1 60% + Asexual Reproduction Gene 1 60%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  R     R  A  R  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCGGAGAGCTCGCTAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right" height="10"&gt;
&lt;/td&gt;   &lt;td height="10"&gt;
&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Attack Gene 5 60% + Asexual    Reproduction Gene 42 60%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  Q     K  R  A  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCAGAAGAGGGCTTAA&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Herbivore Gene 1 80% + Herbivore Gene    15 60% + TEP Gene 16 60%&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  P     C  P  Q  *&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCCTTGTCCGCAGTAG&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt; &lt;/td&gt;   &lt;td&gt; &lt;/td&gt;  &lt;/tr&gt;  &lt;tr&gt;   &lt;td align="right"&gt;Pseudogene&lt;/td&gt;   &lt;td&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;M  H  T  G     F  F  I  I  C  K  M  Y  S     P  P  I&lt;/span&gt;&lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;ATGCACACGGGTTTTTTTATTATTTGTAAAATGTACAGCCCCCCGATT&lt;/span&gt;&lt;/p&gt;   &lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;N  K  A  T  S  L  G  R  G     F  S  L  I  R  G  R&lt;/span&gt;&lt;/p&gt;   &lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;AATAAGGCCACCTCCTTGGGGAGGGGTTTTTCCTTAATAAGGGGTAGG&lt;/span&gt;&lt;/p&gt;   &lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;K  K  V  N  L  D  R  T  *&lt;/span&gt;&lt;/p&gt;   &lt;p&gt;&lt;span style="font-family:Lucida Console;font-size:85%;"&gt;AAAAAAGTTAATTTAGACCGGACCT&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;p&gt; &lt;/p&gt; &lt;table border="0"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td&gt;   &lt;table align="left" border="0"&gt;    &lt;tbody&gt;&lt;tr&gt;     &lt;td&gt;     &lt;p align="left"&gt;&lt;span style="font-size:78%;"&gt;     &lt;a href="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLI_UxJa5DI/AAAAAAAAACk/1_oDlf4Cy0Q/s1600/Chart6.jpg"&gt;     &lt;img src="http://4.bp.blogspot.com/_BnpxRDVAGaM/SLI_U_pE2QI/AAAAAAAAACs/5TZHGeAnYqc/s1600/Chart6_sm.jpg" border="0" height="200" width="400" /&gt;&lt;/a&gt;&lt;/span&gt;&lt;/p&gt;&lt;p align="left"&gt;     &lt;span style="font-size:78%;"&gt;     -output6.dfx&lt;/span&gt;&lt;/p&gt;&lt;p align="left"&gt;     &lt;a href="http://1.bp.blogspot.com/_BnpxRDVAGaM/SLJAtA0A0cI/AAAAAAAAAD8/BUq5jdOLYJg/s1600/World3.jpg"&gt;     &lt;img src="http://3.bp.blogspot.com/_BnpxRDVAGaM/SLJAtHqKznI/AAAAAAAAAEE/OlfPYgMzilw/s1600/World3_sm.jpg" border="0" height="150" width="300" /&gt;&lt;/a&gt;&lt;/p&gt;&lt;p align="left"&gt;     -Omnivore "explosion"&lt;/p&gt;&lt;/td&gt;    &lt;/tr&gt;   &lt;/tbody&gt;&lt;/table&gt;   &lt;p align="justify"&gt;    &lt;b&gt;Carnivore Rise and Falls&lt;/b&gt;:     In early simulations when the program lacked an Age of Maturity (and     thus could immediately reproduce), the scenarios often went through     two major stages of development (see output2.dfx and output3.dfx).      In the first stage, the world was dominated by herbivores.      Once the herbivores evolved to a point where they couldn't extract     any more energy from the environment and became densely populated,     omnivores (and to a lesser degree carnivores) evolved and quickly    took over.  Carnivores and omnivores did emerge before this,    however the population wasn't dense enough for them to take over.  One of the     immediate effects of the omnivores was a massive drop in the     average age of the population from about half the average maximum     age, to just over 1.5 turns, and the average life expectancy     dropping as well (in output3.dfx in settled to an average of about 5     turns).&lt;/p&gt;   &lt;p align="justify"&gt;    After an Age of Maturity was    introduced, the sudden onset of carnivores either happened much later,    or not at all (the more common occurrence).  However, even when    omnivores/carnivores  never took over, omnivores/carnivores often    still appeared when the world became densely populated.  However    instead of a world dominated by omnivores forming, the carnivores would    consume all the local organisms close to them, followed by their    offspring doing the same, until the "explosion" of omnivores or    carnivores expanded too far, and then would either die off from    consuming all the local organisms or from killing each other.  However once the herbivores had     repopulated to area, any surviving omnivores (or any newly evolved     ones) would repeat the cycle.  In cases where the carnivores or    omnivores contain altruistic genes, the omnivores would be able to    spread out even farther without collapse, and even balance out with the    herbivores.  The omnivore/carnivore     "explosions" can be seen in the data by short term rising and     falling of omnivores and carnivores in the data.&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;h3&gt;Genome Length&lt;/h3&gt; &lt;div align="left"&gt; &lt;table border="0" cellspacing="1"&gt;  &lt;tbody&gt;&lt;tr&gt;   &lt;td valign="top"&gt;   &lt;div align="left"&gt;    &lt;table align="left" border="0" cellpadding="0" cellspacing="0"&gt;     &lt;tbody&gt;&lt;tr&gt;      &lt;td&gt;      &lt;a href="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLI-a7H6aiI/AAAAAAAAAB0/6-Y-Eb36EGg/s1600/Chart2.jpg"&gt;   &lt;img src="http://1.bp.blogspot.com/_BnpxRDVAGaM/SLI-beGzCNI/AAAAAAAAAB8/i2DeGLEObu8/s1600/Chart2_sm.jpg" border="0" height="200" width="400" /&gt;&lt;/a&gt;&lt;p&gt;      &lt;span style="font-size:78%;"&gt;- output5.dfx&lt;/span&gt;&lt;/p&gt;      &lt;p&gt;      &lt;a href="http://3.bp.blogspot.com/_BnpxRDVAGaM/SLI-bvZIGyI/AAAAAAAAACE/Ud88uY81zMA/s1600/Chart3.jpg"&gt;   &lt;img src="http://2.bp.blogspot.com/_BnpxRDVAGaM/SLI_Ufbc2nI/AAAAAAAAACM/5Z2HpyTAwk8/s1600/Chart3_sm.jpg" border="0" height="200" width="400" /&gt;&lt;/a&gt;&lt;/p&gt;&lt;p&gt;      &lt;span style="font-size:85%;"&gt;- Genome composition by percent (output6.dfx)&lt;/span&gt;&lt;/p&gt;&lt;/td&gt;     &lt;/tr&gt;    &lt;/tbody&gt;&lt;/table&gt;   &lt;/div&gt;   &lt;p align="justify"&gt;    In all but 1 output, there was a    general increase in genome length over time, with the organisms at the    end having longer genomes then the starting organisms (output1.dfx    showed an increase of over 350 nucleotides).  However, a longer    genome is not always better.  In many cases a shorter genome can be    better.  While shorter genomes seem to be more prone to the    appearance of harmful pseudogenes (due to fewer repeating sequences),    they are therefore also more likely to evolve new beneficial genes.     This is exemplified the most by output4.dfx, that decreased by    approximately 150 nucleotides over the span of its run.  Decreases    in genome length typically seem to occur during periods of large-scale    change (such as the emergence of wide-spread carnivores in output2.dfx    and output3.dfx), forming a pattern of long-term lengthening,    interspaced with short periods of shortening.&lt;/p&gt;   &lt;p align="justify"&gt;    Also, along with longer genome    lengths, there is a general increase in the percent of useful    information over time as the organisms evolve to use more of their    "junk" DNA.  Also, most simulations also show a decrease in the    amount of pseudogene information in the organisms, in both amount and    percent.&lt;/p&gt;&lt;/td&gt;  &lt;/tr&gt; &lt;/tbody&gt;&lt;/table&gt; &lt;/div&gt; &lt;h2 style="line-height: normal; margin-bottom: 0.0001pt;" align="left"&gt;Future  Development&lt;/h2&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Save Function&lt;/b&gt;:  An ability to stop a simulation, save it, and  re-open it later.  This would allow for much longer simulation runs.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Multiple Environments&lt;/b&gt;:  At current, the "world" consists of a single  environment.  An organism that can survive on one square, can survive on  any other square.  Multiple environments, such as a temperature gradient,  or land/water areas may change the way creatures evolve, and create different  niches for organisms to survive and evolve in, more similar to what is seen in  reality.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;New Genes&lt;/b&gt;:  Along with new environments, new genes to allow  organisms to survive in them, such as a gene for breathing in water, and another  for breathing on land, or genes for surviving in different temperature zones.   Also, a gene for eating decaying material, so when an organism dies (and is not  consumed by a carnivore), it decays over time, and any organisms with a  "scavenger" gene may consume the decaying material.  New parenting genes,  such as ones for herbivores to pass on energy to its offspring (similar to an  OET gene, but continue to do so until the offspring has matured), or genes for  organisms with attack genes to come to the defense of other members of its  species.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Chromosomes&lt;/b&gt;:  Along with the basic DNA structure currently modeled,  have the ability of the organisms to evolve chromosomes.  These chromosomes  would have basic telomeres at the ends, and a centromere in the middle, similar  in chromosomes in eukaryotes.  Chromosomes would allow for newer types of  error such as trisomy, etc.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Sexual Reproduction&lt;/b&gt;:  Along with asexual reproduction, organisms  containing chromosomes could also evolve sexual reproduction, mating with other  members of its species, and have their offspring be a combination of their  chromosomes.&lt;/p&gt; &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="justify"&gt;    &lt;b&gt;Using Genes to Control Age&lt;/b&gt;:  Instead of using a separate variable,  outside of the organisms genome, to control lifespan and age of maturity, use  genes to control them instead.  Instead of having a pre-determined maximum  age, have each organism need more energy as it gets older, and have a genes to  control the rate of energy-requirement increase.  Transcription error could  also be reprogrammed to change with age, and have a greater chance of  transcription error as the organism gets older.  Similar with Age of  Maturity, make the energy required to reproduce drop with age, and have the rate  of drop be controlled by genes.&lt;/p&gt; &lt;h2 style="line-height: normal; margin-bottom: 0.0001pt;" align="left"&gt;References&lt;/h2&gt; &lt;ol&gt;&lt;li&gt;  &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="left"&gt;&lt;b&gt;  Elzanowski, Andrzej (Anjay), and Ostell, Jim&lt;/b&gt;.  The Genetic Codes.    (December 4&lt;sup&gt;th&lt;/sup&gt;, 2007) In &lt;i&gt;National Center for Biotechnology   Information&lt;/i&gt;.  Retrieved August 20th, 2008 from  &lt;a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi"&gt;  http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi&lt;/a&gt; &lt;/p&gt;&lt;/li&gt;&lt;/ol&gt; &lt;h3 style="line-height: normal; margin-bottom: 0.0001pt;" align="left"&gt;Raw Data&lt;/h3&gt; &lt;ul&gt;&lt;li&gt;  &lt;p style="line-height: normal; margin-bottom: 0.0001pt;" align="left"&gt;  &lt;a href="http://www.ioss.ca/DOTSraw.zip"&gt;Zip File&lt;/a&gt;  containing the output.dfx files (tab-delimited file, can be read using notepad, or imported/pasted  into Microsoft Excel).&lt;/p&gt;&lt;/li&gt;&lt;/ul&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-47450715074251709?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/47450715074251709/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=47450715074251709' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/47450715074251709'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/47450715074251709'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2008/08/needless-to-say-but-this-post-has-been.html' title='Simulating Natural Selection'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_BnpxRDVAGaM/SLJABwMAfzI/AAAAAAAAAC8/-pYhldDqcRw/s72-c/DOTSscreenshot_sm.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-1206854263394602739</id><published>2007-07-12T04:25:00.000-04:00</published><updated>2007-07-12T23:22:05.631-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='The Bible'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>The Conflicting Genealogies of Jesus</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; In the New Testament, there are two conflicting genealogies given, one in the Gospel of Matthew, and the other in the Gospel of Luke.&amp;nbsp; Now, this is obviously a problem for Christian apologists/literalists who claim that the bible is perfect, and doesn't contradict itself.&amp;nbsp; The most common explanation given is that the one belonging to the Gospel of Matthew describes the genealogy through Joseph (Jesus' father), and the one in the Gospel of Luke is the genealogy through Mary.&amp;nbsp; The are a few other possibilities that people give&lt;sup&gt;[1]&lt;/sup&gt;, but this is by far this seems to be the most common.&amp;nbsp; This article is modified from a
&lt;a href="http://www.rationalresponders.com/forum/rook_hawkins/the_jesus_mythicist_campaign/567"&gt;
post&lt;/a&gt; I made responding to a theist who was trying to claim this.&lt;/p&gt;
&lt;div align="left"&gt;
&lt;table border="1" cellpadding="0" cellspacing="0" style="border-collapse: collapse" bordercolor="#111111" width="300" id="AutoNumber1" align="left"&gt;
  &lt;tr&gt;
    &lt;td width="100%" align="center" colspan="2"&gt;
    &lt;h3&gt;The Two Genealogies of Jesus&lt;/h3&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="50%" align="center"&gt;&lt;b&gt;Gospel of Matthew&lt;sup&gt;[i]&lt;/sup&gt; - 1:1-16&lt;/b&gt;&lt;/td&gt;
    &lt;td width="50%" align="center"&gt;&lt;b&gt;Gospel of Luke - 3:23-38&lt;/b&gt;&lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="50%" valign="top"&gt;&amp;nbsp;&lt;/td&gt;
    &lt;td width="50%" valign="top"&gt;God&lt;br&gt;
    Adam&lt;br&gt;
    Seth&lt;br&gt;
    Enosh&lt;br&gt;
    Kenan&lt;br&gt;
    Mahalalel&lt;br&gt;
    Jared&lt;br&gt;
    Enoch&lt;br&gt;
    Methuselah&lt;br&gt;
    Lamech&lt;br&gt;
    Noah&lt;br&gt;
    Shem&lt;br&gt;
    Arphaxad&lt;br&gt;
    Cainan&lt;br&gt;
    Shelah&lt;br&gt;
    Eber&lt;br&gt;
    Peleg&lt;br&gt;
    Reu&lt;br&gt;
    Serug&lt;br&gt;
    Nahor&lt;br&gt;
    Terah&lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="50%" valign="top"&gt;&lt;b&gt;Abraham&lt;br&gt;
    Isaac&lt;br&gt;
    Jacob&lt;br&gt;
    Judah&lt;br&gt;
    Perez&lt;br&gt;
    Hezron&lt;/b&gt;&lt;br&gt;
    Ram&lt;br&gt;
    &lt;br&gt;
    &lt;b&gt;Admminadab&lt;br&gt;
    Nahshon&lt;/b&gt;&lt;br&gt;
    Salmon&lt;br&gt;
    &lt;b&gt;Boaz&lt;br&gt;
    Obed&lt;br&gt;
    Jesse&lt;/b&gt;&lt;/td&gt;
    &lt;td width="50%" valign="top"&gt;&lt;b&gt;Abraham&lt;br&gt;
    Isaac&lt;br&gt;
    Jacob&lt;br&gt;
    Judah&lt;br&gt;
    Perez&lt;br&gt;
    Hezron&lt;/b&gt;&lt;br&gt;
    Arni&lt;sup&gt;[ii]&lt;/sup&gt;&lt;br&gt;
    Admin&lt;sup&gt;[ii]&lt;/sup&gt;&lt;br&gt;
    &lt;b&gt;Amminadab&lt;br&gt;
    Nahshon&lt;/b&gt;&lt;br&gt;
    Sala&lt;sup&gt;[iii]&lt;/sup&gt;&lt;br&gt;
    &lt;b&gt;Boaz&lt;br&gt;
    Obed&lt;br&gt;
    Jesse&lt;/b&gt;&lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="50%" valign="top"&gt;&lt;b&gt;David&lt;/b&gt;&lt;br&gt;
    Solomon&lt;br&gt;
    Rehoboam&lt;br&gt;
    Abijah&lt;br&gt;
    Asa&lt;br&gt;
    Jehoshaphat&lt;br&gt;
    Jehoram&lt;br&gt;
    -&lt;br&gt;
    -&lt;br&gt;
    -&lt;br&gt;
    Uzziah&lt;sup&gt;[iv]&lt;/sup&gt;&lt;br&gt;
    Jotham&lt;br&gt;
    Ahaz&lt;br&gt;
    Hezekiah&lt;br&gt;
    Manasseh&lt;br&gt;
    Amon&lt;br&gt;
    Josiah&lt;br&gt;
    -&lt;br&gt;
    Jeconiah&lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;b&gt;Shealtiel&lt;/b&gt;&lt;br&gt;
    &lt;b&gt;Zerubbabel&lt;/b&gt;&lt;br&gt;
    Abiud&lt;br&gt;
    Eliakim&lt;br&gt;
    Azor&lt;br&gt;
    Zadok&lt;br&gt;
    Akim&lt;br&gt;
    Eliud&lt;br&gt;
    Eleazar&lt;br&gt;
    Matthan&lt;br&gt;
    Jacob&lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;br&gt;
    &lt;b&gt;Joseph&lt;br&gt;
    Jesus&lt;/b&gt;&lt;/td&gt;
    &lt;td width="50%" valign="top"&gt;&lt;b&gt;David&lt;/b&gt;&lt;br&gt;
    Nathan&lt;br&gt;
    Mattatha&lt;br&gt;
    Menna&lt;br&gt;
    Melea&lt;br&gt;
    Eliakim&lt;br&gt;
    Jonam&lt;br&gt;
    Joseph&lt;br&gt;
    Judah&lt;br&gt;
    Simeon&lt;br&gt;
    Levi&lt;br&gt;
    Matthat&lt;br&gt;
    Jorim&lt;br&gt;
    Eliezer&lt;br&gt;
    Joshua&lt;sup&gt;[v]&lt;/sup&gt;&lt;br&gt;
    Er&lt;br&gt;
    Elmadam&lt;br&gt;
    Cosam&lt;br&gt;
    Addi&lt;br&gt;
    Melki&lt;br&gt;
    Neri&lt;br&gt;
    &lt;b&gt;Shealtiel&lt;/b&gt;&lt;br&gt;
    &lt;b&gt;Zerubbabel&lt;/b&gt;&lt;br&gt;
    Rhesa&lt;br&gt;
    Joanan&lt;br&gt;
    Joda&lt;br&gt;
    Josek&lt;br&gt;
    Semein&lt;br&gt;
    Mattathias&lt;br&gt;
    Maath&lt;br&gt;
    Naggai&lt;br&gt;
    Esli&lt;br&gt;
    Nahum&lt;br&gt;
    Amos&lt;br&gt;
    Mattathias&lt;br&gt;
    Joseph&lt;br&gt;
    Jannai&lt;br&gt;
    Melki&lt;br&gt;
    Levi&lt;br&gt;
    Matthat&lt;br&gt;
    Heli&lt;br&gt;
    &lt;b&gt;Joseph&lt;br&gt;
    Jesus&lt;/b&gt;&lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="100%" valign="top" colspan="2"&gt;
&lt;ol type="i"&gt;
  &lt;li&gt;&lt;font size="2"&gt;&lt;i&gt;I've included a dash where the genealogy in 1 Chronicles   3:5-19 indicates there should be a name.&lt;/i&gt;&lt;/font&gt;&lt;/li&gt;
  &lt;li&gt;&lt;i&gt;&lt;font size="2"&gt;Newer manuscripts omit these two names, and replace it   with Ram.&amp;nbsp; There are also many other variations as well between different   texts.&amp;nbsp; It appears that the text was redacted later to match Matthew (the   earliest manuscript with the redaction to Ram is from the 6th century).&lt;/font&gt;&lt;/i&gt;&lt;/li&gt;
  &lt;li&gt;&lt;i&gt;&lt;font size="2"&gt;Another redaction (earliest manuscript with the   redaction is from the 5th century) done to correct it to Salmon.&lt;/font&gt;&lt;/i&gt;&lt;/li&gt;
  &lt;li&gt;&lt;font size="2"&gt;&lt;i&gt;Azariah in 1 Chronicles 3:12&lt;/i&gt;&lt;/font&gt;&lt;/li&gt;
  &lt;li&gt;&lt;font size="2"&gt;&lt;i&gt;L&lt;/i&gt;&lt;/font&gt;&lt;i&gt;&lt;font size="2"&gt;iterally Jesu (`&amp;#921;&amp;#951;&amp;#963;&amp;#959;&amp;#973;),   which is simply another from of Jesus.&amp;nbsp; This doesn't have anything to do   with the argument, its just an interesting point.&lt;/font&gt;&lt;/i&gt;&lt;/li&gt;
&lt;/ol&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
&lt;/table&gt;
&lt;/div&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; The apologists often make a number of arguments to support their claim:&lt;/p&gt;
&lt;table border="0" cellpadding="0" cellspacing="0" style="border-collapse: collapse" bordercolor="#111111" id="AutoNumber3"&gt;
  &lt;tr&gt;
    &lt;td width="100%"&gt;
    &lt;ol&gt;
      &lt;li&gt;Women were considered inferior to men, so a genealogy through a mother       would have to be represented through the father instead,&lt;/li&gt;
      &lt;li&gt;An prophetic curse giving in Jeremiah 36:30 &amp;quot;Therefore, this is what       the LORD says about Jehoiakim king of Judah: He will have no one to sit on       the throne of David&amp;quot; and that Jesus had to have a second genealogy,&lt;/li&gt;
      &lt;li&gt;Mary is mentioned very often in the first three chapters of Luke, and       thus the genealogy would be from her, and&lt;/li&gt;
      &lt;li&gt;That the line &amp;quot;He was the son, so it was thought, of Joseph&amp;quot;&lt;sup&gt;[2]&lt;/sup&gt;       in the Gospel of Luke's genealogy indicates that the author meant someone       other then Joseph (i.e. Mary).&lt;/li&gt;
    &lt;/ol&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
&lt;/table&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; The first problem with their argument, is the one about a mother's genealogy is represented through the father.&amp;nbsp; This is a bald face lie, and simply isn't true.&amp;nbsp; I have never seen another example of that ever, in or out of the bible (and indeed no one else has either, since it was never done like that).&amp;nbsp; Indeed, the author of Luke even briefly mentions Elizabeth's (Mary's cousin) origins without any problem&lt;sup&gt;[3]&lt;/sup&gt;.&amp;nbsp; While it is customary to include the father along with the mother (usually as &amp;quot;the husband of&amp;quot;), it was certainly not customary to replace the mother's name with the father's.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; In the  table to the left, I've bolded the names where the gospels match each other.&amp;nbsp; Lets start with looking at the names Shealtiel and Zerubbabel, the two names in the middle of the Gospel of Matthew's and the Gospel of Luke's genealogies, between David and Joseph, that match.&amp;nbsp; The significance of these names is that these are descendants of David that came back to Israel after the Babylonian exile, and are mentioned throughout the old testament (Ezra, Nehemiah, etc).&amp;nbsp; Up to this point in the Gospel of Matthew, his genealogy mostly matches up with the one in given in 1 Chronicles 3:5-19 (the only place where this is given).&amp;nbsp; However a number of names are missing in Matthew's from that genealogy (Ahaziah, Joash, and Amaziah between Jehoram and Uzziah, and Jehoiakim between Josiah and Jeconiah).&amp;nbsp; The likely reason for this is because he wanted 14 generations in between each major generation/event (David, the exile in Babylon, and Jesus) as stated in Matthew 1:17.&amp;nbsp; In the Gospel of Luke on the other hand, it seems is completely made up, as the genealogy the author gives doesn't appear anywhere in the old testament.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So right away, we have a major problem with the apologetic argument.&amp;nbsp; In the standard argument, it is said that the genealogies split at David, with Joseph's lineage being followed through Solomon, and Mary's through Nathan's.&amp;nbsp; If that's so, then why the link up at Shealtiel and Zerubbabel?&amp;nbsp; Neither of these names were common,  they appear in the right order, and they both appear in the middle of the genealogies between David and Joseph, meaning that they are almost certainly the same Shealtiel and Zerubbabel mentioned in Matthew, and throughout the old testament.&amp;nbsp; One could argue that the genealogies split here instead, but then you are stuck with two new problems.&amp;nbsp; First of all, your stuck trying to explain why the authors gave conflicting genealogies between David and Shealtiel, and secondly, the apologetic argument shoots itself in the foot now, since Mary would then also be a descendant of Jeconiah, and would thus inherit the same &amp;quot;prophetic curse.&amp;quot;&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Another problem with the genealogy in Luke being from Mary is the large difference in the number of generations between the Gospel of Luke's account and the Gospel of Matthew's account.&amp;nbsp; In Matthew, there are 15 generations between David and Shealtiel , but in Luke, there are 21 generations.&amp;nbsp; Also, between Zerubbabel and Joseph, there is a large difference.&amp;nbsp; In Matthew, there are 10 generations, and in Luke, there are 19, almost twice as much!&amp;nbsp; For a time span this long, it isn't surprising to see one or &lt;i&gt;maybe&lt;/i&gt; two differences in the number of generations (due to one line having offspring at a younger age then the other), but to see a difference like that would be absurd.&amp;nbsp; Some apologists have tried to argue that the Sheatiel and Zerubbabel in the Gospel of Luke are not the same as the ones mentioned in the Gospel of Matthew, and that the Gospel of Luke's Sheatiel and Zerubbabel were not the same ones involved in returning from exile in Babylon, but only named after them, and thus came three or four generations after&lt;sup&gt;[4]&lt;/sup&gt;.&amp;nbsp; Of course, this means now there is a ratio of only 6 or 7 generations to the Gospel of Luke's 19!&amp;nbsp; Utterly preposterous.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So far, I've only talked about the actual genealogies given in the Gospels, and I haven't even talked about what the authors actually say.&amp;nbsp; Here's where things get real fun (for me anyways).&amp;nbsp; Here's where it connects the genealogy to Jesus in Matthew:&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;...and Jacob the father of Joseph, the husband of Mary, and Mary was the mother of Jesus who is called the Messiah.&amp;quot; - Matthew 1:16, TNIV&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; And in Luke:&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;He was the son, so it was thought, of Joseph, the son of Heli...&amp;quot; - Luke 3:24, TNIV&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; In the beginning of the Gospel of Luke, Mary's name is mentioned a total of 15 times, however, not a single one of these occurrences has anything to do with genealogy.&amp;nbsp; Every single reference is part of the Gospel of Luke's telling of Jesus' birth and childhood (and often it is &amp;quot;Joseph and Mary&amp;quot;).&amp;nbsp; Not only that, every single one of them is in the first two chapters, chapter 3 (the one that contains the genealogy, which is given after his baptism, and when Jesus was about thirty) doesn't contain a single reference to Mary (by name, or any other way).&amp;nbsp; Saying that her name appears often in the first three chapters is a gross misrepresentation of the facts.&amp;nbsp; Indeed, these 15 references in the first two chapters are the ONLY references to Mary, in the entire of Gospel of Luke (unless you include Luke 11:27 were some random lady in a crowd shouts out &amp;quot;Blessed is the mother who gave you birth and nursed you.&amp;quot;).&amp;nbsp; Overall, the author of Luke doesn't seem very concerned with Mary, other then to pump out Jesus during the nativity story (which the genealogy isn't a part of).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; As the apologists seem think, the designation &amp;quot;supposedly&amp;quot; (or &amp;quot;so it was thought&amp;quot; in the translation here (from the TNIV)) from Luke 3:23 seems to signify some a genealogy from Mary from some how.&amp;nbsp; However you don't really say how it does, you just say it indicates that its saying Jesus wasn't the biological son of Joseph, and then jump to the claim that that must mean the genealogy here is from Mary.&amp;nbsp; Let's look at what the concerning part in Luke 3:23 says in the original Koine Greek:&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;&amp;#969;&amp;#957; &amp;#965;&amp;#953;&amp;#959;&amp;#962;, &amp;#969;&amp;#962; &amp;#949;&amp;#957;&amp;#959;&amp;#956;&amp;#953;&amp;#950;&amp;#949;&amp;#964;&amp;#959;&amp;quot; (oon huios, hoos enomizeto)&lt;sup&gt;[5]&lt;/sup&gt;&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;&amp;#969;&amp;#957; &amp;#965;&amp;#953;&amp;#959;&amp;#962;&amp;quot; simply means &amp;quot;He was the son&amp;quot;, but &amp;quot;&amp;#969;&amp;#962; &amp;#949;&amp;#957;&amp;#959;&amp;#956;&amp;#953;&amp;#950;&amp;#949;&amp;#964;&amp;#959;&amp;quot; is the interesting part.&amp;nbsp; &amp;#969;&amp;#962; is particle this is used to compare, and be translated as &amp;quot;as, like, as though, as if, on the grounds that, on the pretext of, etc.&amp;quot;&amp;nbsp; &amp;#949;&amp;#957;&amp;#959;&amp;#956;&amp;#953;&amp;#950;&amp;#949;&amp;#964;&amp;#959; is the aorist (basically past tense, but not that simple) passive of the verb &amp;#957;&amp;#959;&amp;#956;&amp;#953;&amp;#950;&amp;#969; (meaning &amp;quot;I suppose/consider&amp;quot;), so basically &amp;#949;&amp;#957;&amp;#959;&amp;#956;&amp;#953;&amp;#950;&amp;#949;&amp;#964;&amp;#959; means &amp;quot;He was  supposed/considered.&amp;quot;&amp;nbsp; I would basically translate the whole phrase as &amp;quot;He was the son, as he was considered&amp;quot; (which is pretty close to what most seem to translate, albeit mine is a bit more word for word).&amp;nbsp; So basically the author is making a disclaimer, the author is saying is that although he knows that Jesus isn't the physical son of Joseph, he was considered his son, so he is going to use Joseph in the genealogy.&amp;nbsp; The author of Matthew also seems to be doing something similar, by placing Mary in between Joseph and Jesus.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So why the big difference between the gospels?&amp;nbsp; Most scholars agree that the Gospel of Matthew was written sometime late in the last two decades of the first century 1&lt;sup&gt;st&lt;/sup&gt; century&lt;sup&gt;[6]&lt;/sup&gt;.&amp;nbsp; Also, most scholars seem to agree that the author of Matthew was a Jew himself (or was a Jew before becoming a Christian), and shows a great deal of knowledge of Judaism and the Tanakh (The Old Testament).&amp;nbsp; Subsequently, he knows of the genealogy of Shealtiel and Zerubbabel from 1 Chronicles 3:5-19, so he included it with some generations missing.&amp;nbsp; It seems most likely that the reason he took out four generations was so he could keep the number of generations even (14).&amp;nbsp; However, to get 14 in each group, you have to cheat a bit and count Jeconiah in both the line between David and the exile, and in the line between the exile and Jesus.&amp;nbsp; Whereas you don't count David twice.&amp;nbsp; It's also interesting to note that of the four people missing from his genealogy, one of them is Jehoiakim, the one who received the prophetic curse.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; The author of Luke on the other hand, doesn't seem to have the same level of knowledge of Jewish culture and the Tanakh, and probably was a Gentile before becoming a Christian.&amp;nbsp; Also, this gospel was written much later, and was probably written sometime in the early 2&lt;sup&gt;nd&lt;/sup&gt; century.&amp;nbsp; This can be seen by the authors apparent use of the works of a late 1&lt;sup&gt;st&lt;/sup&gt; century historian named Josephus Flavius&lt;sup&gt;[7]&lt;/sup&gt;, and the appearance of an early 2&lt;sup&gt;nd&lt;/sup&gt; century Gnostic leader named Simon Magus (or Simon the Sorcerer as he is called) in Acts 8:9-24.&amp;nbsp; By this point, knowledge of the Tanakh may not have been as important to Christians as it was when the Gospel of Matthew was written, which would be especially true for a non-Jewish author.&amp;nbsp; As such, the author may have known about Shealtiel and Zerubbabel (who are mentioned many times in the Old Testament), but was unfamiliar with the genealogy that appears for them in 1 Chronicles 3:5-19.&amp;nbsp; As such, he had to create a genealogy between Nathan (who is mentioned as on of David's sons in other places such as 2 Samuel 5:14) and Shealtiel, as well as between Zerubbabel and Joseph.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So put simply.&amp;nbsp; Each author of the two gospels wanted to create a full history of Jesus, since each author believed in a historical Jesus and wanted others to as well, but were stuck working with what they had.&amp;nbsp; Neither had a genealogy between Zerubbabel and Joseph, but the author of Matthew had a bit more knowledge of the Tanakh, so he was able to include more from the Tanakh, and didn't have to make up as much.&amp;nbsp; This leads to one undeniable conclusion about the authors of these two gospels (although plenty continue to deny it), and that is the fact that gospel writers had no problem making things up, and presenting them as fact, to try and convince people that Jesus existed.&amp;nbsp; And this, among many other reasons, is exactly why the gospels can not be trusted as a source for historical information.&lt;/p&gt;
&lt;table border="0" cellpadding="0" cellspacing="0" style="border-collapse: collapse" bordercolor="#111111" id="AutoNumber2"&gt;
  &lt;tr&gt;
    &lt;td&gt;
    &lt;ol&gt;
      &lt;li&gt;Genealogy of Jesus. (July 6&lt;sup&gt;th&lt;/sup&gt;, 2007). In &lt;i&gt;Wikipedia, The       Free Encyclopedia&lt;/i&gt;. Retrieved July 12&lt;sup&gt;th&lt;/sup&gt;, 2007 from
      &lt;a href="http://en.wikipedia.org/wiki/Genealogy_of_Jesus"&gt;
      http://en.wikipedia.org/wiki/Genealogy_of_Jesus&lt;/a&gt;&lt;/li&gt;
      &lt;li&gt;&lt;b&gt;Mass, A.J.&lt;/b&gt;&amp;nbsp; (1909).&amp;nbsp; &lt;i&gt;Genealogy of Christ&lt;/i&gt;.&amp;nbsp;       In &lt;i&gt;The Catholic Encyclopedia,&lt;!--/work--&gt;
      &lt;!--volume--&gt;Volume VI [Electronic version]&lt;/i&gt;.&amp;nbsp; New York: Robert       Appleton Company.&amp;nbsp; Retrieved July 12th, 2007 from
      &lt;a href="http://www.newadvent.org/cathen/06410a.htm"&gt;
      http://www.newadvent.org/cathen/06410a.htm&lt;/a&gt;&lt;/li&gt;
      &lt;li&gt;Luke 1:5, TNIV&lt;/li&gt;
      &lt;li&gt;Luke 3:23, TNIV&lt;/li&gt;
      &lt;li&gt;Luke 3:23, United Bible Societies' Greek New Testament: 4&lt;sup&gt;th&lt;/sup&gt;       Edition&lt;/li&gt;
      &lt;li&gt;&lt;b&gt;Kirby, Peter&lt;/b&gt;. (2001). &lt;i&gt;Gospel of Matthew&lt;/i&gt;. Retrieved July 9&lt;sup&gt;th&lt;/sup&gt;,       2007 from &lt;a href="http://www.earlychristianwritings.com/matthew.html"&gt;
      http://www.earlychristianwritings.com/matthew.html&lt;/a&gt;&lt;/li&gt;
      &lt;li&gt;&lt;b&gt;Carrier, Richard&lt;/b&gt;. (2006) &lt;i&gt;The Date of the Nativity in Luke (5&lt;sup&gt;th&lt;/sup&gt;       Edition)&lt;/i&gt;. Retrieved July 12th, 2007 from
      &lt;a href="http://www.infidels.org/library/modern/richard_carrier/quirinius.html"&gt;
      http://www.infidels.org/library/modern/richard_carrier/quirinius.html&lt;/a&gt;&lt;/li&gt;
    &lt;/ol&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
&lt;/table&gt;
&lt;p&gt;&amp;nbsp;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-1206854263394602739?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/1206854263394602739/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=1206854263394602739' title='10 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/1206854263394602739'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/1206854263394602739'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2007/07/conflicting-genealogies-of-jesus.html' title='The Conflicting Genealogies of Jesus'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>10</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-9190435956003974612</id><published>2007-07-11T12:06:00.000-04:00</published><updated>2007-07-11T20:13:34.053-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Creationism'/><title type='text'>Kent Hovind, What a Fucktard</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; For those who don't know who &lt;a href="http://en.wikipedia.org/wiki/Kent_Hovind"&gt;Kent Hovind&lt;/a&gt; is, he is a creationist from the United States who is well known for spewing the most inane nonsense to support his views on Creationism.&amp;nbsp; He calls himself a doctor, although his Ph.D. is in &amp;quot;Christian Education&amp;quot; and comes from and unaccredited university called Patriot Bible University.&amp;nbsp; In simple words &amp;quot;his Ph.D. ain't worth shit!&amp;quot;&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Kent Hovind also has a &amp;quot;standing offer of $250,000 to anyone who can give any empirical evidence (scientific proof) for evolution&amp;quot; that can be found on an obscure &lt;a href="http://www.drdino.com/articles.php?spec=67"&gt;article&lt;/a&gt; on his Dr. Dino website (and I do mean obscure, the only way it seems to able to find it, is by entering a search for it).&amp;nbsp; However, as with much of what this &amp;quot;fucktard&amp;quot; peddles (see the below YouTube video), it's basically a scam.&amp;nbsp; First of all, his challenge is impossible to win, because his idea of evolution is fundamentally flawed.&amp;nbsp; Here are the fours things that he says evolution is being taught as in school:&lt;/p&gt;
&lt;ol&gt;
  &lt;li&gt;Brought time, space, and matter into existence from nothing.&lt;/li&gt;
  &lt;li&gt;Organized that matter into the galaxies, stars, and at least nine planets   around the sun. (This process is often referred to as cosmic evolution.)&lt;/li&gt;
  &lt;li&gt;Created the life that exists on at least one of those planets from   nonliving matter (chemical evolution).&lt;/li&gt;
  &lt;li&gt;Caused the living creatures to be capable of and interested in reproducing   themselves.&lt;/li&gt;
  &lt;li&gt;Caused that first life form to spontaneously diversify into different   forms of living things, such as the plants and animals on the earth today   (biological evolution).&lt;/li&gt;
&lt;/ol&gt;
&lt;p&gt;So let's see which points actual deal with evolution.&lt;/p&gt;
&lt;ol&gt;
  &lt;li&gt;Evolution says nothing about the origins of the universe.&amp;nbsp; Absolutely   nothing.&lt;/li&gt;
  &lt;li&gt;Evolution doesn't talk about the &amp;quot;evolution&amp;quot; of the universe.&amp;nbsp; That   belongs to the fields of Physics and Cosmology.&amp;nbsp; He simply using the term (The   Theory of Evolution) out of its original context (Biological/Darwinian   evolution).&lt;/li&gt;
  &lt;li&gt;Again, he is using the term for evolution out of its original context.&amp;nbsp;   Life forming from non-living material is called abiogenesis, it has nothing to   do with evolution.&lt;/li&gt;
  &lt;li&gt;That part is true, however that is only one of the results of evolution,   not what evolution itself is.&lt;/li&gt;
  &lt;li&gt;Spontaneously?&amp;nbsp; This coming from a guy who thinks the life (as we see it)   was created in 6 days instead of evolving over 3.8 billion years?&amp;nbsp; There is   nothing spontaneous about evolution.&amp;nbsp; Biological evolution is a slow, gradual   process that takes anywhere from thousands to billions of years.&amp;nbsp; Heck, the   first multi-cellular life doesn't even seem to appear for almost 2.8 billion   years after life first appeared.&amp;nbsp; In other words, for almost three quarters of   the history of life on this planet, life barely did anything except cover the   planet in blue-green algae.&lt;/li&gt;
&lt;/ol&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp; &amp;nbsp;So, in the 5 points that Dr. Hovind (and I use &amp;quot;Dr.&amp;quot; very loosely) states evolution is being taught as, he only gets one right, and that one isn't even what evolution is, it is one of the results of evolution.&amp;nbsp; Of course, that's not only the only part where he confuses what evolution is.&amp;nbsp; Here's his list of known options for his &amp;quot;observed phenomena&amp;quot; are:&lt;/p&gt;
&lt;ol&gt;
  &lt;li&gt;The universe was created by God.&lt;/li&gt;
  &lt;li&gt;The universe always existed.&lt;/li&gt;
  &lt;li&gt;The universe came into being by itself by purely natural processes (known   as evolution) so that no appeal to the supernatural is needed. &lt;/li&gt;
&lt;/ol&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp; &amp;nbsp;Firstly, saying that there are only three options for how the universe is, is simply stupid.&amp;nbsp; I'd love to put it more nicely then that, but I can't, it is just stupid.&amp;nbsp; Even if we can only imagine the most minute amount of possibilities, I'm sure there are infinite amounts of possibilities.&amp;nbsp; This is one of the most beautiful and humbling aspects of science.&amp;nbsp; Science helps us see those possibilities, and to guide us to the truth.&amp;nbsp; This is something that I doubt Dr. Hovind will understand.&amp;nbsp; The second problem with this list, is that he says that evolution states that the universe came into being by itself.&amp;nbsp; As I mentioned before, evolution does not deal with the origin of the universe, it doesn't even deal with the origin of life, it simply explains how life can go from a simple beginnings (like bacteria) to greater more complex creatures (like us).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp; &amp;nbsp;There is also the list that he says you have to disprove to collect the $250,000:&lt;/p&gt;
&lt;ol&gt;
  &lt;li&gt;The earth is not billions of years old (thus destroying the possibility of   evolution having happened as it is being taught).&lt;/li&gt;
  &lt;li&gt;No animal has ever been observed changing into any fundamentally different   kind of animal.&lt;/li&gt;
  &lt;li&gt;No one has ever observed life spontaneously arising from nonliving matter.&lt;/li&gt;
  &lt;li&gt;Matter cannot make itself out of nothing.&lt;/li&gt;
&lt;/ol&gt;
&lt;p&gt;My response:&lt;/p&gt;
&lt;ol&gt;
  &lt;li&gt;Proving that the earth is billions of years old, that's easy.&amp;nbsp; We have   tons of radiometric dating to tell us how old the earth is, and we can look at   the expansion of the universe to tell how old the universe is.&amp;nbsp; There are more   ways of course, but I want to get to some more of Hovind's nonsense.&lt;/li&gt;
  &lt;li&gt;And for good reason, there is no reason we should, as evolution doesn't   work like that.&amp;nbsp; Indeed, seeing something spontaneously change into something   fundamentally different (either be itself, or in a single generation) would   prove evolution false.&amp;nbsp; Hovind is supporting evolution here, and he doesn't   even know it! &lt;/li&gt;
  &lt;li&gt;Yet again, Hovind is suggesting that evolution states something it   doesn't.&amp;nbsp; Not only does evolution say nothing about the origin of life, modern   theories about abiogenesis don't even state this.&lt;/li&gt;
  &lt;li&gt;I'm starting to get sick of repeating myself.&amp;nbsp; Yet again, Hovind is   suggesting that evolution states something it doesn't.&amp;nbsp; Indeed, I can't think   of any accepted theory in science that calls for this.&lt;/li&gt;
&lt;/ol&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp; &amp;nbsp;Hovind, like many anti/pseudo-scientists, says he can disprove evolution and that creationism is science, but Hovind can't do either because he doesn't understand the basics of evolution, or how science works.&amp;nbsp; I'd laugh at him, but I'm too busy shaking my head at the fact that so many people actually listen to this criminal.&amp;nbsp; And yes, he literally is a criminal.&amp;nbsp; On January 19&lt;sup&gt;th&lt;/sup&gt;, 2007 he was sentenced to 10 years in prison for $600,000 worth in tax fraud.&amp;nbsp; Which brings me to this YouTube video:&lt;/p&gt;
&lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/cEGEl4uHQAU"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;
  &lt;embed src="http://www.youtube.com/v/cEGEl4uHQAU" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;
&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-9190435956003974612?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/9190435956003974612/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=9190435956003974612' title='11 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/9190435956003974612'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/9190435956003974612'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2007/07/kent-hoving-what-fucktard.html' title='Kent Hovind, What a Fucktard'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>11</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-9218947816035572723</id><published>2007-06-16T02:09:00.000-04:00</published><updated>2007-06-16T04:14:09.777-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Intelligent Design'/><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Creationism'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><category scheme='http://www.blogger.com/atom/ns#' term='Pseudoscience'/><title type='text'>Ottawa Centre of the Royal Astronomical Society of Canada officially rejects Creationism and Intelligent Design</title><content type='html'>&lt;p&gt;&lt;img border="0" src="http://bp1.blogger.com/_BnpxRDVAGaM/RnOaTTIjcwI/AAAAAAAAABc/7ELKoXzLIuo/s1600/rasc_logo.jpg" align="left" width="157" height="157" alt="Logo of the Royal Astronomical Society of Canada"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I wanted to post this when it was announced in May, but I haven't been able to due to time and work constraints (as evident by the fact I haven't posted anything since February), and the fact I've spent most of my posting time arguing against Theists on the forums at &lt;a href="http://www.rationalresponders.com/"&gt;The Rational Response Squad&lt;/a&gt; (RRS).&amp;nbsp; On April 26&lt;sup&gt;th&lt;/sup&gt;, the  &lt;a href="http://ottawa.rasc.ca"&gt;Ottawa Centre&lt;/a&gt; of the  &lt;a href="http://www.rasc.ca/"&gt;Royal Astronomical Society of Canada&lt;/a&gt; approved a position officially rejecting Creationism:&lt;/p&gt;
&lt;blockquote&gt;
&lt;p style="text-align: justify;"&gt;&lt;i&gt;The RASC Ottawa Centre supports high standards of scientific integrity, academic freedom and the free exchange of ideas. It also respects the scientific method and recognizes that the validity of any scientific model comes only as a result of rational hypotheses, sound experimentation, and findings that can be replicated by others. &lt;/i&gt;&lt;/p&gt;
&lt;p style="text-align: justify;"&gt;&lt;i&gt;The RASC Ottawa Centre, then, is unequivocal in its support of contemporary evolutionary theory that has its roots in the seminal work of Charles Darwin and has been refined by findings accumulated over 140 years. &lt;/i&gt;&lt;/p&gt;
&lt;p style="text-align: justify;"&gt;&lt;i&gt;Some dissenters from this position are proponents of non-scientific explanations of the nature of the universe. &amp;nbsp;These may include “creation science”, “creationism”, “intelligent design” or other non-scientific “alternatives to evolution”. While we respect the dissenters’ right to express their views, these views are theirs alone and are in no way endorsed by the RASC Ottawa Centre. &amp;nbsp;It is our collective position that these explanations do not meet the characteristics and rigour of scientific empiricism.&lt;/i&gt;&lt;/p&gt;
&lt;p style="text-align: justify;"&gt;&lt;i&gt;Therefore the science agenda of the RASC Ottawa Centre and its publications will not promote any non-scientific explanations of the nature of the universe.&lt;/i&gt;&lt;/p&gt;
&lt;/blockquote&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I was at the meeting on May 4&lt;sup&gt;th&lt;/sup&gt; when this was announced, and must have had a smile going from ear to ear.&amp;nbsp; As most people can guess, I am VERY much against the spread of Creationism.&amp;nbsp; In deed, some of my longest posts at the RRS have been against Creationism (although lately I've been &lt;a href="http://www.rationalresponders.com/forum/rook_hawkins/biblical_errancy/7968"&gt;debating&lt;/a&gt; the authorship of the Gospel of John, and the letters that the Church has attributed to him).&amp;nbsp; It seems also that &lt;a href="http://ottawa.rasc.ca/articles/odale_chuck/earth_craters/index.html"&gt;Charles O'Dale&lt;/a&gt; (the man who spear-headed this, and who gave me a beer for &lt;a href="http://flyingbagpiper.blogspot.com/2006/11/my-trip-to-holleford-crater.html"&gt;finding and photographing the Holleford Crater&lt;/a&gt;) also has an interest in making sure that we put an end to this Creation nonsense.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; My biggest problem with Creationism and Intelligent Design, isn't so much the theories they put forward, but the way they do it.&amp;nbsp; Instead of using real science, they circumvent science with politics to get their &amp;quot;theories&amp;quot; taught in schools, and use pseudoscience (or perhaps, more appropriately anti-science) to try and prove them.&amp;nbsp; Also, because they don't use proper science, when this gets taught in schools children and students get taught an incorrect view of how science and proper deductive reasoning works.&amp;nbsp; The horrible thing about this, is when these pseudoscientific ideas affect decisions regarding matters of health (like going to see a miracle healer instead of a proper doctor), and cause real harm to people and their children.&amp;nbsp; Perhaps worth still, is the fact we, and our friends in the United States, have elected many of these people who fall victim to creationism and is pseudoscience friends.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; It is important that we put a quick stop to Creationism, Intelligent Design, and all pseudoscience.&amp;nbsp; Hopefully more RASC Centers, and many other scientific organizations will officially reject Creationism and the like, and we can quickly put an end to all this nonsense.&amp;nbsp; If you are a member of any type of organization, centre, or club that is based around science, no matter how small, I highly encourage you to follow in the footsteps of Mr. O'Dale and others like him, and try to get your organization to do the same.&amp;nbsp; And if you need help doing it, or getting information, there are many people out there willing to lend a hand, &lt;a href="mailto:piper2000ca@yahoo.ca"&gt;myself&lt;/a&gt; included.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-9218947816035572723?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/9218947816035572723/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=9218947816035572723' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/9218947816035572723'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/9218947816035572723'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2007/06/ottawa-centre-of-royal-astronomical.html' title='Ottawa Centre of the Royal Astronomical Society of Canada officially rejects Creationism and Intelligent Design'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://bp1.blogger.com/_BnpxRDVAGaM/RnOaTTIjcwI/AAAAAAAAABc/7ELKoXzLIuo/s72-c/rasc_logo.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-4801552508965369436</id><published>2007-02-12T17:06:00.000-05:00</published><updated>2007-02-12T17:09:57.835-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Intelligent Design'/><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Evolution'/><category scheme='http://www.blogger.com/atom/ns#' term='Creationism'/><title type='text'>It's My Birthday!</title><content type='html'>&lt;p&gt;&lt;img border="0" src="http://bp2.blogger.com/_BnpxRDVAGaM/RdDk7NLQXYI/AAAAAAAAABE/FeGj7UlzLts/s1600/Charles_Darwin.jpg" align="left" width="150" height="187"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Not only is today my birthday, but it also happens to be the birthday of someone who I greatly admire.&amp;nbsp; Charles Darwin.&amp;nbsp; So I figured I would talk about Evolution, Natural Selection, and the battle against creationism and &amp;quot;intelligent&amp;quot; design.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Intelligent design basically says that things are so complex, and so complicated, that an intelligent designer (God) must have done it.&amp;nbsp; Right away, intelligent design shows its greatest weakness, in that it sees something that is difficult to explain, and it just gives up, saying &amp;quot;God did it.&amp;quot;&amp;nbsp; Needless to say, this isn't the first time and imaginary god has been used to explain.&amp;nbsp; People used to think that god raised and set the sun every day, but we know now that it is a result of the rotation of the Earth, and its orbit around the sun.&amp;nbsp; People used to think that disease was the cause of an angry god, pissed off at our sins.&amp;nbsp; Of course, we know that diseases are caused by thinks like viruses, and bacteria.&amp;nbsp; The same thing with natural disasters like earthquakes and tornadoes.&amp;nbsp; Sadly, despite science showing exactly what causes these, many people are still dumb enough to believe that it caused by our sins.&amp;nbsp; Maybe I should stop wearing clothes made from multiple fabrics (According to Leviticus 19:19, this is sinful).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Unlike intelligent design, Natural Selection has an elegant simplicity that shows how you can go from a very simple organism, to something completely different, that has the appearance of design to it.&amp;nbsp; Basically how it works, is you start out with a very simple organisms.&amp;nbsp; These organisms have offspring, and each offspring has small changes in their genes.&amp;nbsp; Most of these changes don't have any benefit, but some do, and those ones have a better chance of reproducing then the ones who don't.&amp;nbsp; What happens of course, is that the next generation is bit better suited to its environment then the one before it.&amp;nbsp; Over a great deal of time, with each generation getting a bit better, you get a completely different organism that appears &amp;quot;designed&amp;quot; for its environment.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Unfortunately, despite being so simple a child could understand it, creationists would have you believe that none of it is true, and that &amp;quot;God did it.&amp;quot;&amp;nbsp; With incredibly religious people like George Bush leading the United States, and religion being pushed on every aspect of human life, creationism and intelligent design, has gotten a new and stronger hold in schools and in society.&amp;nbsp; Luckily, here in Canada, religion and the state is very separate, and evolution is much more widely accepted.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Luckily for the states though, things seem to be getting a bit better.&amp;nbsp; Even places like Kansas, where people are very religious and where most people believe in creationism, schools are rejecting intelligent design from being taught in schools.&amp;nbsp; Slowly, but surely, creationism is dying.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Perhaps the easiest way to show that intelligent design is false, is the countless examples in biology of vestigial structures.&amp;nbsp; Humans have things like an appendix and a tail bone.&amp;nbsp; Even the largest whales still have undeveloped hind legs.&amp;nbsp; Needless to say, these are only a few examples.&amp;nbsp; In fact, you could look at almost every species around us, and you could probably find some example of a vestigial structure.&amp;nbsp; Evolution and natural selection explain these very well, but intelligent design can't.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I'd like to talk about it more, and I'm sure I will again on a later date, but I've come down with a bit of a cold (I guess god is pissed off at my sins again).&amp;nbsp; So I will leave you with two videos.&amp;nbsp; The first one is called &amp;quot;The Atheists Nightmare.&amp;quot;&amp;nbsp; It is an argument for intelligent design by a man named Ray Comfort, and it is so bad, that when I first saw it, I actually thought it was a video mocking creationists.&amp;nbsp; The second video is a response to it, and shows how the banana became what it s today.&amp;nbsp; Enjoy, and have a happy Darwin Day!&lt;/p&gt;
&lt;table border="0" cellpadding="0" cellspacing="0" style="border-collapse: collapse" bordercolor="#111111" width="100%" id="AutoNumber1"&gt;
  &lt;tr&gt;
    &lt;td width="50%"&gt;
    &lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/Y4yBvvGi_2A"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;
      &lt;embed src="http://www.youtube.com/v/Y4yBvvGi_2A" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
  &lt;tr&gt;
    &lt;td width="50%"&gt;
    &lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/aLqQttJinjo"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;
      &lt;embed src="http://www.youtube.com/v/aLqQttJinjo" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;
    &lt;/td&gt;
  &lt;/tr&gt;
&lt;/table&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-4801552508965369436?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/4801552508965369436/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=4801552508965369436' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/4801552508965369436'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/4801552508965369436'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2007/02/not-only-is-today-my-birthday-but-it.html' title='It&apos;s My Birthday!'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://bp2.blogger.com/_BnpxRDVAGaM/RdDk7NLQXYI/AAAAAAAAABE/FeGj7UlzLts/s72-c/Charles_Darwin.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-2694441371456917464</id><published>2007-01-04T23:19:00.000-05:00</published><updated>2007-01-04T23:56:05.639-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='The Bible'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>Is the Bible Based on Love and Hope?  My Response to a YouTube Post</title><content type='html'>&lt;p&gt;&lt;img border="0" src="http://bp2.blogger.com/_BnpxRDVAGaM/RZ3Y9UL-FLI/AAAAAAAAAAU/9QHJzysHEPg/s400/buddychrist1.png" align="left" width="189" height="400" alt="&amp;quot;If anyone comes to me and does not hate father and mother, wife and children, brothers and sisters—yes, even life itself—such a person cannot be my disciple.&amp;quot; Luke 14:26"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Today, I got an interesting reply to my video response to the Blasphemy Challenge (see my last post) from somebody named brittanykamalei.&amp;nbsp; I wanted to reply on YouTube, but it only lets you do 500 characters, so I needed to make my reply here.&amp;nbsp; For those who have not seen my video response, and do not know what she had posted, this was her response:&lt;/p&gt;
&lt;blockquote&gt;joseph, you must not have had a thorough reading of the Bible. Not a hint of hope? no love? that is what the Bible is based on. well actually, it is a great war, but war cannot be without love in defending something. God and Jesus and the Holy Spirit are desperately trying to defend the people whom they love so much: us. Satan is real. Good luck.&lt;/blockquote&gt;
&lt;p&gt;&lt;i&gt;&lt;b&gt;My Response:&lt;/b&gt;&lt;/i&gt;&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Obviously I was exaggerating when I said there was no hope or love (Although not by much).&amp;nbsp; As for it being based on love and hope like you said, well, I'll let the bible do the talking:&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;You are free to eat from any tree in the garden; but you must not eat from the tree of the knowledge of good and evil, for when you eat of it you will certainly die.&amp;quot; Genesis 2:16-17 (Not only does God not want you to know the difference between good and evil, he threatens Adam with death if he does.&amp;nbsp; Interestingly, God doesn't kill Adam, instead he throws him out of the Garden of Eden)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;I will make your pains in childbearing very severe; with pain you will give birth to children. Your desire will be for your husband, and he will rule over you.&amp;quot; Genesis 3:16 (Self-explanatory)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;A woman should learn in quietness and full submission. I do not permit a woman to teach or to assume authority over a man; she must be quiet.&amp;quot; 1 Timothy 11-12 (Self-explanatory)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;If anyone comes to me and does not hate father and mother, wife and children, brothers and sisters—yes, even life itself—such a person cannot be my disciple.&amp;quot; Luke 14:26 (Jesus wants you to hate those around you, so you can love him more)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;For some are eunuchs because they were born that way; others have been made eunuchs; and others have renounced marriage because of the kingdom of heaven. The one who can accept this should accept it.&amp;quot; Matthew 19:12 (If you can castrate yourself, your should do so.&amp;nbsp; Sadly, many people (sometimes by the thousands) who have been fooled into believing the bible have done exactly this).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;Anyone who is unwilling to work shall not eat.&amp;quot; 2 Thessalonians 3:10 (Self-explanatory)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;I tell you that anyone who looks at a woman lustfully has already committed adultery with her in his heart. If your right eye causes you to stumble, gouge it out and throw it away. It is better for you to lose one part of your body than for your whole body to be thrown into hell. And if your right hand causes you to stumble, cut it off and throw it away. It is better for you to lose one part of your body than for your whole body to go into hell.&amp;quot;&amp;nbsp; Matthew 5:28-30&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;I, the LORD your God, am a jealous God, punishing the children for the sin of the parents to the third and fourth generation of those who hate me.&amp;quot; Exodus 20:5 (This actually comes from part of the 10 commandments)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;The Ten Commandments&amp;quot; Exodus 20:1-17 (I won't bother to name them here, but the &amp;quot;loving&amp;quot; part of God shows here when he says all of them are punishable by death, so you better not try and worship other gods, or work on the Sabbath, because &amp;quot;the loving Yahweh&amp;quot; thinks you should die for it)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;Whoever is captured will be thrust through; all who are caught will fall by the sword. Their infants will be dashed to pieces before their eyes; their houses will be looted and their wives ravished.&amp;quot; Isaiah 13:15-16 (On invading another land, God wants you to kill all captives, and cut babies to pieces in front of their mothers (while you’re rapping them I guess, because he wants you to &amp;quot;ravish&amp;quot; them too).&amp;nbsp; Wow, that is one loving God.)&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; &amp;quot;If your very own brother, or your son or daughter, or the wife you love, or your closest friend secretly entices you, saying, “Let us go and worship other gods” (gods that neither you nor your ancestors have known, gods of the peoples around you, whether near or far, from one end of the land to the other), do not yield to them or listen to them. Show them no pity. Do not spare them or shield them. You must certainly put them to death. Your hand must be the first in putting them to death, and then the hands of all the people. Stone them to death, because they tried to turn you away from the LORD your God.&amp;quot; Deuteronomy 13:6-10 (Pretty self-explanatory, but just to drill the point in a little more:&amp;nbsp; If your own child converts to another religion, and suggests you should also, YOU are to stone them to death!&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Feeling the love yet?&amp;nbsp; Hope?&amp;nbsp; And of course, these are just a few of the hundreds of murderous, horrendous, terrifying, sexist, racist, hateful, awful things in the bible.&amp;nbsp; As for the few parts that actually do talk about love, God (and Jesus) make it very clear that they only apply to those who believe in him (and not even then sometimes).&amp;nbsp; Let's face it, the bible (especially the old testament) is arguably one of the most disgusting and vile works of fiction ever written, and I honestly feel ashamed that I ever called it a &amp;quot;good&amp;quot; book.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-2694441371456917464?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/2694441371456917464/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=2694441371456917464' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/2694441371456917464'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/2694441371456917464'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2007/01/is-bible-based-on-love-and-hope-my.html' title='Is the Bible Based on Love and Hope?  My Response to a YouTube Post'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://bp2.blogger.com/_BnpxRDVAGaM/RZ3Y9UL-FLI/AAAAAAAAAAU/9QHJzysHEPg/s72-c/buddychrist1.png' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-2508035232870512298</id><published>2006-12-21T03:14:00.000-05:00</published><updated>2006-12-21T03:18:12.012-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='The Bible'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>The Blasphemy Challange</title><content type='html'>&amp;nbsp;&amp;nbsp;&amp;nbsp; The great people at the &lt;a href="http://www.rationalresponders.com/"&gt;Rational Response Squad&lt;/a&gt; have put up a nice little challenge.&amp;nbsp; You can win a free DVD of &lt;a href="http://www.thegodmovie.com/"&gt;The God Who Wasn't There&lt;/a&gt;, and all you have to do, is risk going to hell.&amp;nbsp; Basically, post a video of you on You Tube saying &amp;quot;I deny the existence of the Holy Spirit.&amp;quot;&amp;nbsp; Apparently, priests can rape little boys and be ok, but deny the power of God, and its off to hell!&amp;nbsp; I could go on further, but here's the explanatory video from &lt;a href="http://www.blasphemychallenge.com"&gt;The Blasphemy Challenge&lt;/a&gt;:&lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/i7QVbJnSPQE"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/i7QVbJnSPQE" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; And here is my response:&lt;/p&gt;&lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/Tg2yFhk5tgI"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/Tg2yFhk5tgI" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/p&gt;
&lt;p align="left"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; For fellow Canadians (and all non-Americans) who are thinking of taking the challenge, and are hoping to win a free DVD, you will have to pay US$8.00 for shipping and handling.&lt;/p&gt;
&lt;p align="left"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; As I said in my response, I hope others will take this challenge, and more importantly, I hope that others will finally step away from religion.&amp;nbsp; We don't need to be afraid to do this.&amp;nbsp; I know that people are afraid of living in a world without God, that it will be a world of suffering, and one where all the good things people do will end.&amp;nbsp; However, one of the things that you realize when you de-convert, is that we always have been living in a world without God, and all of the good things that we can do, will still be there.&amp;nbsp; From the ugliest war, to the most beautiful cathedral, humanity has created it all.&amp;nbsp; When you stop believing that God controls the world and everything in it, you discover that humanity can solve all its problems all by its self.&amp;nbsp; We don't need to believe in a God, we just need to believe in each other.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-2508035232870512298?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/2508035232870512298/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=2508035232870512298' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/2508035232870512298'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/2508035232870512298'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/12/blasphemy-challange.html' title='The Blasphemy Challange'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-3650874219567059169</id><published>2006-12-04T00:02:00.000-05:00</published><updated>2006-12-04T00:05:54.483-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='The Bible'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>Religion and Morality</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; According to the Bible (and many other religious books), Atheists are fools, and are evil and corrupt.&amp;nbsp; Hopefully, even the moderately religious can see that this is a bunch of bull, but sadly (as the movie &lt;a href="http://www.jesuscampthemovie.com"&gt;Jesus Camp&lt;/a&gt; demonstrates), many are raised to believe this as fact.&amp;nbsp; In case you are one of them, or perhaps think that Christians, or the religious, are more likely to be moral and good then Atheists, I would like to share with you this video:&lt;/p&gt;
&lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/7i4Ek-XBk0U"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/7i4Ek-XBk0U" type="application/x-shockwave-flash" wmode="transparent" width="425" height="350"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/p&gt;
&lt;p align="left"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Along with this, I would like to add some information from an article I read in Skeptic magazine (Vol. 12 No. 3, 2006) titled &amp;quot;Religious Belief and Societal Health,&amp;quot; written by Mathew Provonsha.&amp;nbsp; The article graphs things that are considered immoral like abortion (granted, most Atheists would not consider abortion immoral, but I'll come back to that later), teenage pregnancy, and homicide rates with religious themes/beliefs such as creationism, prayer rates, church attendance, and percentage of the population who call themselves religious.&amp;nbsp; To no surprise, the more religious a nation is, the more likely it is to have a higher rates of abortion, higher rates of murder, teenage pregnancy, and teenage mothers.&amp;nbsp; In case you are wondering, rates are given in &amp;quot;per 1,000&amp;quot; and not total number.&amp;nbsp; Also, to no surprise, the country that leads the rates of all of these factors, is the very religious, very non-secular United States.&amp;nbsp; To be fair, I'm willing to bet that a good chunk of the United States' problem is due to the fear-mongering of its media and government, but this may be due to religion anyways because as we all know, religion has always been famous for fear-mongering, and I could easily see it being adopted by the media and the government.&amp;nbsp; Now, it's interesting to note, that the more religious (and also more &amp;quot;pro-life&amp;quot;) a country is, the higher rate of abortion it has.&amp;nbsp; It wasn't mentioned in the article, but I'm willing to assume that this is because the more secular a country is, the more likely it is to endorse contraception in the classroom, so that when teenagers inevitably have sex, they don't get pregnant in the first place (hence the lower teenage pregnancy rates), and therefore abortion (which, as I mention above, most Atheists don't consider immoral anyways), doesn't become a factor in the first place.&amp;nbsp; But of course, you shouldn't listen to me, because according to the Holy Bible:&lt;/p&gt;
&lt;h2 align="center"&gt;&lt;i&gt;I am a &amp;quot;fool&amp;quot;&lt;/i&gt;&lt;/h2&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-3650874219567059169?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/3650874219567059169/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=3650874219567059169' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/3650874219567059169'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/3650874219567059169'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/12/religion-and-morality.html' title='Religion and Morality'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-4570301256328376030</id><published>2006-11-28T11:52:00.000-05:00</published><updated>2006-11-28T12:41:19.095-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Islam'/><category scheme='http://www.blogger.com/atom/ns#' term='Iraq'/><category scheme='http://www.blogger.com/atom/ns#' term='George Bush'/><category scheme='http://www.blogger.com/atom/ns#' term='war'/><category scheme='http://www.blogger.com/atom/ns#' term='Al-Qaeda'/><title type='text'>United States is Losing to Al-Qaeda</title><content type='html'>&lt;p&gt;&lt;img border="0" src="http://photos1.blogger.com/blogger2/6206/4439/1600/IraqAlAnbar.png" alt="Al-Anbar Governate (picture courtesy of Wikipedia)" align="left" width="200" height="201"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; As usual, things are getting worse, and worse in Iraq.&amp;nbsp; According to a Marine Corps Intelligence Report, the United States has lost the province of &lt;a href="http://en.wikipedia.org/wiki/Al-Anbar"&gt;Al-Anbar&lt;/a&gt; to Al-Qaeda and the insurgency (&lt;a href="http://www.msnbc.msn.com/id/15926797/"&gt;MSNBC: Anbar picture grows clearer, and bleaker&lt;/a&gt;).&amp;nbsp; In other words, &amp;quot;it's a huge shit sandwich, and we're all gonna have to take a bite.&amp;quot; (Lieutenant Lockhart: &lt;a href="http://www.imdb.com/title/tt0093058/"&gt;Full Metal Jacket&lt;/a&gt;).&amp;nbsp; Instead of &amp;quot;liberating&amp;quot; Iraq from the evil Saddam Hussein, President Bush has doomed Iraq to be ruled by yet another petty religious theocracy.&amp;nbsp; Because as things are going, Iraq will fall into civil war once the United States leaves, and a government funded by Al-Qaeda and religious extremists will take over.&amp;nbsp; And the thing that fucking pisses me off, is that Bush doesn't even think civil war is beginning to become a problem in Iraq (&lt;a href="http://www.cnn.com/2006/WORLD/meast/11/28/iraq.main/index.html"&gt;CNN: Bush denies civil war is engulfing Iraq&lt;/a&gt;)!&amp;nbsp; Bush, you are a FUCKING MORON!&amp;nbsp; Go suck rotten donkey dick you fucking dumbass!&amp;nbsp; Ok, now that I got that off my chest, lets continue.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; The thing about this report that show just how bad it is, is that it wasn't written by Al-Qaeda, or a third party, is that it was written by the United States Marine Corp themselves, the same people who are fighting in Iraq.&amp;nbsp; You know things have gone to shit for you when you don't even think you're winning.&amp;nbsp; Shit, I still can't believe Bush thinks they aren't losing the war.&amp;nbsp; And just to add insult to injury for the rest of the world, after a religious government takes over in Iraq, Al-Qaeda will once again have a center for training and development.&amp;nbsp; This means big problems for the rest of us, including countries like Canada (my country), who didn't even take part in Iraq.&amp;nbsp; Just to make things worse, Iraq used to have an infrastructure for developing nuclear weapons, and the missiles/rockets to deliver them, while Afghanistan and the other places Al-Qaeda was in didn't.&amp;nbsp; So now, Al-Qaeda (or a government very sympathetic to them) will be in a country with the technology and the means to develop nuclear weapons.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Now, this bleak future doesn't mean that the western world is doomed, but it does mean that after the United States leave Iraq, we will have to go back in later, and do this all over again.&amp;nbsp; Thank you Bush, you doomed us to another half-century of war and death.&amp;nbsp; Fuck.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-4570301256328376030?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/4570301256328376030/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=4570301256328376030' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/4570301256328376030'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/4570301256328376030'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/united-states-is-losing-to-al-qaeda.html' title='United States is Losing to Al-Qaeda'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116440715451945697</id><published>2006-11-24T14:33:00.000-05:00</published><updated>2006-11-24T17:25:57.380-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Astronomy'/><category scheme='http://www.blogger.com/atom/ns#' term='Geology'/><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='Flying'/><title type='text'>My Trip to the Holleford Crater</title><content type='html'>&lt;p&gt;&lt;a href="http://photos1.blogger.com/x/blogger/2794/4064/1600/219778/1044191.jpg"&gt;&lt;img border="0" src="http://photos1.blogger.com/x/blogger/2794/4064/1600/869391/1044191_small.jpg" align="right" alt="BE-19 Sport (not the one I fly, the picture is courtesy of www.airliners.net)" width="344" height="228"&gt;&lt;/a&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Instead of my usual bitching and complaining, I thought I do something a bit different, and talk about my recent trip (yesterday actually) to the Holleford crater.&amp;nbsp; The Holleford crater is a 550 Million year old simple crater, about 2.5 kilometers wide, and about 20 miles north of Kingston, Ontario.&amp;nbsp; The reason for this is trip was simple, to win a free beer.&amp;nbsp; I know, I could probably buy dozens of beers for the price it cost me to rent the plane (the 2.3 hour flight cost me $292), but as any guy could tell you, that doesn't matter when beer is part of the bet.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; The bet began quite a few months ago, shortly after my first solo, when I asked &lt;a href="http://ottawa.rasc.ca/astronomy/earth_craters/index.html"&gt;Chuck O'Dale&lt;/a&gt; (a friend of mine from the Ottawa Centre of the Royal Astronomical Society of Canada who has a mutual interest in geology and craters) if he knew of any craters near Ottawa that I could fly to and photograph from the air.&amp;nbsp; He suggested that I try and find the &lt;a href="http://www.ottawa.rasc.ca/articles/odale_chuck/earth_craters/holleford/index.html"&gt;Holleford&lt;/a&gt; crater, and just to up the anti, he said that if I could get to it, and find it without using my plane's GPS, he would buy me a free beer.&amp;nbsp; The reason for this was simple, the Holleford crater isn't that easy to find, in fact, unless you know exactly what you are looking for, you would fly over it without ever noticing it.&lt;/p&gt;
&lt;p&gt;&lt;a href="http://photos1.blogger.com/x/blogger/2794/4064/1600/497562/NorthField.jpg"&gt;&lt;img border="0" src="http://photos1.blogger.com/x/blogger/2794/4064/1600/659453/NorthField_small.jpg" alt="The North field of the Ottawa International Airport (taken from the right seat of a Katana a few months before)" align="left" width="259" height="194"&gt;&lt;/a&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Part of the bet was that I could get the Latitude and the Longitude from the internet (otherwise I wouldn't know where to start looking), so after getting all the information I needed from Chuck's webpage about the Holleford crater (he had actually been there before, as with virtually every crater in Canada), I began planning the flight down there.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So, yesterday, I filed my flight plan, hopped in my flying school's (&lt;a href="http://www.ottawaflighttraining.com"&gt;Ottawa Aviation Services&lt;/a&gt;) BE-19 Sport, and started flying down to the crater.&amp;nbsp; Now, some people don't like the BE-19 because it's quite slow (In fact, on a flight back from Toronto, I once got passed by a helicopter heading the same way), but I love this plane.&amp;nbsp; It's like flying a big couch, as it is a whole lot more comfortable then the DA-20 Katana that I trained in (a fun little 2-seater, and amazing trainer, but its bucket seats are quite uncomfortable over a long time), and it has a really good GPS (which I couldn't use on this flight).&amp;nbsp; Also, its slower speed is perfect for observing things on the ground.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Before I left, I was told about some fog to the south, right between Ottawa and Kingston, but I didn't think that it would be a problem since there was some fog in the morning in Ottawa, but it had burned away by then.&amp;nbsp; So, at 12:23hrs (EST) I took off from Ottawa International Airport, and began heading towards the crater.&amp;nbsp; The first thing I see after taking off, was fog on the horizon to the south.&amp;nbsp; Now, I've been flying for a while now (well, long enough anyways, not nearly as much as compared to commercial pilots, or other pilots like Chuck), so one thing I've learned about scary things on the horizon, is that don't be scared away by it (but don't be stupid either and ignore it), fly a bit closer, and then decide if it really is a threat, and in this case (as with many previous cases), it wasn't a threat at all, and turned out to be quite beautiful in fact.&lt;/p&gt;
&lt;p&gt;&lt;a href="http://photos1.blogger.com/x/blogger/2794/4064/1600/370942/FogBank.jpg"&gt;&lt;img border="0" src="http://photos1.blogger.com/x/blogger/2794/4064/1600/664256/FogBank_small.jpg" alt="Fog Bank south of Ottawa" align="right" width="260" height="195"&gt;&lt;/a&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; After I passed by the fog bank, the flight was pretty quiet and very smooth flying.&amp;nbsp; On route I passed by Perth and Smith Falls (not much of an interest to most, to my dad used to live there before he moved up north) as I had done a number of times before going to Toronto and Kingston.&amp;nbsp; When I began to get to where the crater was, I started looking at the wrong lake, and nearly flew straight over the crater.&amp;nbsp; Luckily, I had seen the image of Holleford crater (and namely the small lake beside it) so many times, that when I turned my head a bit to the left I saw the lake, and the crater.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I started circling the crater at 4500ft (the same altitude I used to get down there with), and I tell you, what a beautiful site!&amp;nbsp; I studied Geology at Carleton University, and so whenever I fly over some type of Geological feature, I always feel excited, especially when I know what created it.&amp;nbsp; The great thing about craters, is that it combines my love of Astronomy, with my love of Geology.&lt;/p&gt;
&lt;p&gt;&lt;a href="http://photos1.blogger.com/x/blogger/2794/4064/1600/109130/HollefordCrater.jpg"&gt;&lt;img border="0" src="http://photos1.blogger.com/x/blogger/2794/4064/400/248134/HollefordCrater_small.jpg" align="left" alt="Holleford Crater, taken from an altitude of 4500ft" width="259" height="194"&gt;&lt;/a&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; After circling the crater for a few minutes at 4500ft, I climbed the plane up to 6500ft, for a higher view.&amp;nbsp; When I finally got bored with that altitude, and took another dozen pictures, I descended to 3500ft and took a few more pictures before heading back to Ottawa.&amp;nbsp; On my flight plan, I had set 25 minutes for surveying the crater, but instead, I took more closer to 40 minutes.&amp;nbsp; Luckily they don't start worrying about you being late till you are 2 hours past your arrival time.&amp;nbsp; On the way back, I was surprised to find that the fog I had passed on my way down to the crater, was still there (although it had moved further southeast).&amp;nbsp; Arrival went smoothly, and I landed without difficulty.&amp;nbsp; Now I just have to make sure that Chuck keeps his promise.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116440715451945697?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116440715451945697/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116440715451945697' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116440715451945697'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116440715451945697'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/my-trip-to-holleford-crater.html' title='My Trip to the Holleford Crater'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116312513307899097</id><published>2006-11-09T21:16:00.000-05:00</published><updated>2006-11-09T21:24:52.126-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>"Kids on Fire" Bible Camp Closed After Documentary</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Score one for reason!&amp;nbsp; After getting a tremendous amount of bad publicity from the movie&lt;a href="http://www.jesuscampthemovie.com/"&gt;Jesus Camp&lt;/a&gt;, the &amp;quot;Kids on Fire&amp;quot; bible camp has been closed down (&lt;a href="http://www.torontodailynews.com/index.php/WorldNews/2006110814Kids-Camp"&gt;Toronto Daily News: Controversial Religious Summer Camp Closed&lt;/a&gt;).&amp;nbsp; Thank Goodness!&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I haven't seen Jesus Camp yet (only a few clips, and the trailer for it), but I have read a number of reviews (&lt;a href="http://richarddawkins.net/article,183,Surviving-Jesus-Camp,Josh-Timonen"&gt;Surviving 'Jesus Camp' by Josh Timonen&lt;/a&gt; is a really good), and from what I have read and seen, that camp (and those like it) is one of the most disturbing things I have ever seen.&amp;nbsp; Watching these kids is so sad, and so upsetting that I want to throw up.&amp;nbsp; The indoctrination and mental abuse that these kids have to endure (religion seems to be very good at that, in all its sick forms) is painful to even think about, but it happens all the time, and it seems only a few people really care.&amp;nbsp; If you doubt the threat to our children, and our future, that camps like this (and the people that run them) present, I recommend you watch this movie:&lt;/p&gt;
&lt;p align="center"&gt;&lt;object width="425" height="350"&gt;&lt;param name="movie" value="http://www.youtube.com/v/y_EKHK1C2IE"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;
  &lt;embed src="http://www.youtube.com/v/y_EKHK1C2IE" type="application/x-shockwave-flash" wmode="transparent" width="400" height="300"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116312513307899097?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116312513307899097/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116312513307899097' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116312513307899097'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116312513307899097'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/kids-on-fire-bible-camp-closed-after.html' title='&quot;Kids on Fire&quot; Bible Camp Closed After Documentary'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116304305479033519</id><published>2006-11-08T21:45:00.000-05:00</published><updated>2006-11-08T22:30:54.826-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Judaism'/><category scheme='http://www.blogger.com/atom/ns#' term='Islam'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><category scheme='http://www.blogger.com/atom/ns#' term='Christianity'/><title type='text'>Vatican Wants to Ban Gay-Pride Parade in Jerusalem</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Well, here we go again (&lt;a href="http://www.cbc.ca/cp/world/061108/w1108100.html"&gt;CBC: Vatican asks Israel to ban planned gay pride parade in Jerusalem&lt;/a&gt;).&amp;nbsp; The Vatican is yet again saying homosexuality is offensive and &amp;quot;intrinsically disordered.&amp;quot;&amp;nbsp; This is exactly the type of hateful, homophobic, nonsense trash that finally pushed me away from religion (maybe I should thank them for that, keep up the good work pope).&amp;nbsp; The biggest argument they have is that it will be offensive the faithful of the city.&amp;nbsp; However, when Muslims in the area begin protesting against Israel and the Jews, and start saying that they should all die and burn in hell, the Vatican remains completely silent (same thing goes for Jews protesting against Muslims, and Christians in the states protesting against, well, everything).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; And so what if a bunch of gays want to go parading?&amp;nbsp; Are they hurting anybody (like religion often does)?&amp;nbsp; Are they trying to make others like themselves (like religion)?&amp;nbsp; Do they rape and pillage (like religion)?&amp;nbsp; Do they try to force others to follow their ways (like religion)?&amp;nbsp; No, no, no, and no.&amp;nbsp; As usual, the church is more concerned about other peoples sex-lives, then doing what is truly just and moral.&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; One of the things that tick me off the most, is how they say this &amp;quot;would offend the religious sentiments of believers.&amp;quot;&amp;nbsp; So if people find it offensive, they should ban it?&amp;nbsp; Just because something is offensive, IT DOES NOT MEAN IT SHOULD BE BANNED!!&amp;nbsp; People find things offensive all the time.&amp;nbsp; I don't think you can find a single thing that isn't offensive to someone.&amp;nbsp; I'm sure you can find people that think puppy dogs, children, and the letter Q are offensive.&amp;nbsp; It doesn't fucking matter.&amp;nbsp; People have the right to say what they want, and consenting adults should be able to fuck each other as they please.&amp;nbsp; Also, religion shouldn't be getting any special privileges anyways.&amp;nbsp; If it was a &amp;quot;communist-pride&amp;quot; parade, do you think the Vatican would complain?&amp;nbsp; If it was Christian fundamentalists advocating for the destruction of the &amp;quot;Zionist&amp;quot; state of Israel, and the eradication of the Muslims, does anybody think for a second that the Vatican would ask to have them banned because it would &amp;quot;offend the religious sentiments of believers?&amp;quot;&amp;nbsp; Of course not, and that's for one simple reason:&lt;/p&gt;
&lt;p align="center"&gt;&lt;b&gt;RELIGION = FUCKING HYPOCRISY&lt;/b&gt;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116304305479033519?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116304305479033519/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116304305479033519' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116304305479033519'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116304305479033519'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/vatican-wants-to-ban-gay-pride-parade.html' title='Vatican Wants to Ban Gay-Pride Parade in Jerusalem'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116275914936650858</id><published>2006-11-05T14:56:00.000-05:00</published><updated>2006-11-05T15:39:09.380-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Islam'/><category scheme='http://www.blogger.com/atom/ns#' term='Iraq'/><category scheme='http://www.blogger.com/atom/ns#' term='George Bush'/><category scheme='http://www.blogger.com/atom/ns#' term='Death Penalty'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><title type='text'>Saddam is Going to the Gallows</title><content type='html'>&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; So, they have sentenced Saddam Hussein to death (&lt;a href="http://www.cbc.ca/world/story/2006/11/05/saddam-verdict.html"&gt;CBC: Saddam sentenced to death&lt;/a&gt;).&amp;nbsp; Geez, what a fucking surprise.&amp;nbsp; Along with him, his half brother (Barzan Ibrahim), and Awad Hamad al-Bandar al-Saadun (the head of the old Revolutionary court) have also been sent to death.&amp;nbsp; Three others were sentenced to 15 years, and one person (Mohammed Assam Al-Ali) was actually acquitted (that was a bit of a surprise).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Now, of course, this is likely to set off more sectarian violence, but that's not a surprise either, simply because everything in Iraq sets off more sectarian violence.&amp;nbsp; Sadly, it seems that the people in Iraq don't want to stop killing and torturing each other (I hear drills are a popular method for torture), until everyone is dead.&amp;nbsp; Saddam Hussein (who was a Sunni Muslim) was fairly popular amongst the Sunni's of his country (he gave all his top jobs to Sunnis, and showered them with gifts), so needless to say, they are really pissed off (well, more pissed off I should say, they're not exactly happy about the Americans invading Iraq either) and are threatening even more violence (this doesn't actually change a fucking thing, considering they are the biggest instigators of violence in Iraq anyways).&amp;nbsp; As for the Shi'ites, they were pretty badly treated by Saddam, constantly being tortured, murdered, and disappearing under his regime (come to think of it, that isn't very different from how it is today).&lt;/p&gt;
&lt;p&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; As for myself, I'm very, very happy that he has been convicted (although it was obvious that's what would happen).&amp;nbsp; However, I have always been, and still am, very much against the death penalty for ANYONE.&amp;nbsp; Unless you are acting in self-defence, or are a soldier fighting in war, I firmly believe you have absolutely no right to take another humans life.&amp;nbsp; Don't get me wrong, I do not think Saddam Hussein should be set free, indeed, I would like to see that fucking bastard rot in Abu Ghraib for the rest of his life (shit, give him to that &lt;a href="http://en.wikipedia.org/wiki/Lynndie_England"&gt;Specialist England&lt;/a&gt; chick), if anything, death only takes away from his punishment.&amp;nbsp; As an Atheist, I don't believe in a heaven, nor do I believe in a hell.&amp;nbsp; After you die, you will cease to exist, our time on this planet is all the reality we have.&amp;nbsp; This isn't really as bad as it sounds, after all, you and I didn't exist for almost 14 Billion Years before we born, and we didn't complain once about it.&amp;nbsp; Death means an end to suffering, pain, and sadness, and in the case of Saddam (and people like him) it also means an end to punishment.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116275914936650858?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116275914936650858/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116275914936650858' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116275914936650858'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116275914936650858'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/saddam-is-going-to-gallows.html' title='Saddam is Going to the Gallows'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116239896596178242</id><published>2006-11-01T10:45:00.001-05:00</published><updated>2006-11-01T20:19:43.580-05:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='Science'/><category scheme='http://www.blogger.com/atom/ns#' term='religion'/><category scheme='http://www.blogger.com/atom/ns#' term='Reason'/><title type='text'>The Richard Dawkins Foundation for Reason &amp; Science, and My Conversion to Atheism</title><content type='html'>&lt;p align="justify"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I've always enjoyed reading, and there's a book I'm reading right now called "&lt;a href="http://richarddawkins.net/godDelusion"&gt;The God Delusion&lt;/a&gt;." I was going to give a review of the book after I finished reading it (and indeed I will), but I just can't wait to say something, because out of all the books that I have read, this one ranks near the top (if not the top) of those that have change my life.&lt;/p&gt;
&lt;p align="justify"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; I used to be a pretty devote Anglican, I didn't believe in such nonsense as the story of Noah, or Adam and Eve, but I had no doubt in the existence of God, and that Jesus was my saviour. I even went on a pilgrimage once to Toronto to see Pope John Paul II (a very moving experience, and once that I am still glad I did, even if John Paul II's beliefs and morals could be a bit backwards). But then, at my probably most devout point in my life, I started to read the bible. And as Penn Jillette (of Penn and Teller) once said "Nothing will make you an Atheist faster, then reading the damn bible!"&lt;/p&gt;
&lt;p align="justify"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; After reading the bible, I found that it contained virtually nothing of what I believed in, not to mentioned glaring inconsistencies (And I mean glaring, it is amazing how much the bible contradicts itself, and creates obvious problems). It provoked hate, racism, sexism, rape, murder, paranoia, fear, and even what seems to be pedophilia. I was disgusted at what it contained, disgusted that I had followed it so faithfully, and embarrassed that I had called it "my religion." After this, I was somewhere between an agnostic, and a deist. I wasn't sure if there was a god, but I didn't think it was the Christian god, or god of any of the world's other religions. If he existed, he was simply the creator of the universe, and of heaven.&lt;/p&gt;
&lt;p align="justify"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Then I saw a documentary called "The Root of All Evil?" (You can download it and watch it from Torrent Spy &lt;a href="http://www.torrentspy.com/torrent/782215/Richard_Dawkins_The_Root_of_All_Evil_2006"&gt;here&lt;/a&gt;), narrated by a man named Richard Dawkins. I still wasn't an Atheist at this point, but I was pretty damn close. After watching it, I was inspired to purchase his book The God Delusion. By the second chapter, I became a full fledge Atheist. And I am very proud of it.&lt;/p&gt;
&lt;p align="center"&gt;&lt;font size="4"&gt;Richard Dawkins, &lt;i&gt;I Thank You&lt;/i&gt;&lt;/font&gt;&lt;/p&gt;
&lt;p align="justify"&gt;&amp;nbsp;&amp;nbsp;&amp;nbsp; Now, Richard Dawkins has set up a charity called "The Richard Dawkins Foundation for Reason &amp; Science." He has set it up to help support science, research, and education; and to fight superstition, ignorance, and pseudoscience. I could explain it further, but I suggest you watch his introductory video &lt;a href="http://richarddawkins.net/foundation,ourMission"&gt;here&lt;/a&gt;. You can also donate to the foundation, as I have done, and I highly encourage others to do so. There is do much ignorance, fear and hate in this world, and we need to do everything to stop it. I consider it probably the greatest problem the human race has ever faced (and indeed has been facing for all our history). Greater then even global warming (Indeed, I consider ignorance one of the founding problems that has led to global warming).&lt;/p&gt;
&lt;p align="center"&gt;&lt;a href="http://richarddawkins.net" target="_blank"&gt;&lt;img height="72" alt="RichardDawkins.net" src="http://richarddawkins.net/banners/392x72_RDFbanner.jpg" width="392" border="0" /&gt;&lt;/a&gt;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116239896596178242?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116239896596178242/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116239896596178242' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116239896596178242'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116239896596178242'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/11/richard-dawkins-foundation-for-reason_01.html' title='The Richard Dawkins Foundation for Reason &amp; Science, and My Conversion to Atheism'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-36370494.post-116138768172683291</id><published>2006-10-20T18:58:00.000-04:00</published><updated>2006-10-20T19:44:24.226-04:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='atheism'/><category scheme='http://www.blogger.com/atom/ns#' term='George Bush'/><category scheme='http://www.blogger.com/atom/ns#' term='morality'/><title type='text'>Ah Christ, not another fucking blog</title><content type='html'>&lt;p&gt;Ya, I know, now there's another blog out there. I'm sure that some people (if anybody is actually reading this), is thinking "here's another wackjob who thinks his voice is important enough to be heard. What an arrogant fuck!" Well, you’re absolutely right, and it’s for two reasons: &lt;/p&gt;&lt;ol&gt;&lt;li&gt;Everybody's voice is important enough to be heard (even the wackjobs and arrogant fucks). We call this Democracy (some politicians seem to forget this, and need to be reminded of it every once and a while, ahem, Bush) and;&lt;/li&gt;&lt;li&gt;I am sick to death of what I see happening in the world today. Political corruption, attacks on science and reason in the name of religion, the attack on civil liberties and freedom (especially in the United States), censorship (namely state censorship) and the spreading of fear and hate across the world.&lt;/li&gt;&lt;/ol&gt;&lt;p&gt;So what does this mean for this blog? Well, mostly a whole bunch of ranting about what I see in the news, and my views on them. Although I don't have a degree or doctorate in any sciences, I've always regarded myself as a bit of a scientist, so whenever I state any facts on this blog, I will try and post a reference for it so nobody thinks I'm pulling facts out of my ass. And of course, I always encourage discussion and comment, so if you feel like I've said something wrong, immoral or you simply don't agree with, I'd like to hear from you. Your comment may even start another post.&lt;/p&gt;&lt;p&gt;Now, I strongly believe in free speech. Very strongly, so if I step on somebody's toes, insult there religious values, or any thing else they find offensive, I do apologize, but I will not be censored, nor do I think anybody should be censored, even the most right-wing, bigot, racist, fascist, mother-fucking neo-Nazi skinhead. With that said, for comments, if it is just gibberish (i.e. people slamming random keys on the keyboard), advertisements, or people attacking other people (this blog, and the comments, are for ideas, not direct insults at people who have made comments), I will moderate those comments as I see appropriate (feel free to make fun of politicians or other major figures, they're fair game).&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/36370494-116138768172683291?l=flyingbagpiper.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://flyingbagpiper.blogspot.com/feeds/116138768172683291/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=36370494&amp;postID=116138768172683291' title='3 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116138768172683291'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/36370494/posts/default/116138768172683291'/><link rel='alternate' type='text/html' href='http://flyingbagpiper.blogspot.com/2006/10/ah-christ-not-another-fucking-blog.html' title='Ah Christ, not another fucking blog'/><author><name>Joseph "Piper" Morgan</name><uri>http://www.blogger.com/profile/08589320399646132492</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='24' height='32' src='http://photos1.blogger.com/blogger/2794/4064/400/MyPortrait.jpg'/></author><thr:total>3</thr:total></entry></feed>
