Thursday, August 28, 2008

Response to "5 Questions Every Intelligent Atheist Must Answer"

- Watch the below video, and you might need a few of these

I first heard of this video (5 Questions Every Intelligent Atheist Must Answer) by philos71 from RabidApe's response to it. I decided to listen to the video first and answer it myself. At first, the video looked well put together, and maybe I would even be treated to questions that would actually pose a challenge and cause me to think. Fuck was I wrong. Instead, I was "treated" to the usual stupid strawman arguments for creationism, and a big fucking headache. However, I will still answer them, and pop a few aspirins. I've included the time the questions where made in the video in brackets.

The headache actually begins even before the questions. Even before a full minute has elapsed (46 seconds to be exact) he claims that the questions are a problem for your "atheistic belief system." Oh Christ. As has been said by every single atheist I know, there is no such thing as an "atheistic belief system." The only belief that all atheists have in common, is that they lack belief in a god, that's it, and it's not even a common belief, its a common lack of belief! Right away, the strawman arguments begin.

  1. (1:17) Aren't you using "chance" in the exact same way in which you accuse Christians of using "God of the Gaps"? - No. Not even fucking close. It is a regular creationist claim that science evokes random chance and events for evolution, the big bang, and basically anything and everything that doesn't agree with the bible. Of course, science doesn't use chance to explain anything. As for cases where science genuinely doesn't know, we don't answer with "it was chance," we honestly say we don't know, and then search for the answer,

  2. (2:25) Why should there be something instead of nothing? - This is really just stupid, and is just the basic argument from design. He saying that because we exist, a god must exist. Needless to say, I could easily ask the question "Why should a god exist instead of no god?" Of course I already know the creationists answer to this, a god exists outside of time, and doesn't have a beginning. In deed, according to him "Every intelligent person knows that this world came into existence at some point in time." In itself, this is already a fairly narrow view of reality, as the universe itself could exists outside of time, and time simple an element of that universe (ie, if you had a box of water, the water would be dependant on the box, not the other way around). Also, and unfortunately for philos71, his statement on what "every intelligent person knows" is not what most physicists and cosmologists believe. Yes, the universe as we know it began approximately 13.73 billion years ago[1]. However, this is not to say that nothing existed before that. As I understand, many string theorists believe that our universe was formed to the collision of two branes, and the "multiverse" that this happened in has always existed. In deed the properties of this universe that philos71 claims are fine-tuned for life may have been set by the collision itself. Naturally with an infinite number of branes, an infinite number of collisions and subsequent universes, naturally some of them are going to be able to support life. Also, he talks about how the Earth itself is fine-tuned for life. Needless to say, he has this backwards, life is fine-tuned for the Earth it lives on. If Earth was closer to the sun, and life evolved on it, it would evolve to be best adapted to that hotter Earth, and same idea if the Earth was farther from the sun. He even evokes "Moral Order" in the same light (i.e. why have morals instead of not?). Which brings him, and unfortunately my headache, to the next points. If you haven't started popping aspirins yet, I suggest you crack open your bottle, you're going to need them for these:

  3. (3:54) Where do you get your morals from? - Here he ends up into a huge strawman argument, and the only thing he gets close to right, is that morals can evolve (although he invokes groups selection to do it, so ends up quickly dropping the ball). But were the real idiocy here is, is that he says that the organism itself has to know that self-sacrificing behavior is beneficial to the species, and that because we didn't know about evolution and genetics till the 19th century, altruistic behavior couldn't have existed before that (at least without a god). He even goes as far as to say that animals find it easier to kill opposition and lack the moral behaviors that we do. Of course, this isn't even close to what biologists believe about the evolution of group behaviors such as reciprocal altruism (doing good on to others, in the hope that they may do good unto you later). As for his claim about animals usually killing competition, this is outright wrong. In most cases where a species lives in a group (like humans and other primates), killing is not only rare, it is often punished. There's no active thought in this behavior, it is pure instinct, and yes, this instinct evolves over time. In the game "Prisoner's dilemma" where two players either have to betray their partner (and get a large reward, the other jail), or stay silent and help there partner who hopefully doesn't betray him (and both get a small reward), the best strategies were ones that were inherently co-operative, namely tit-for-tat (the basics of reciprocal altruism)[2]. Indeed, I'd be interested to hear him explain why social creatures such as monkeys, apes, lions, whales, etc. exhibit "morals" such as altruism, despite the fact that they clearly do not believe in god. Anyone want to bet that he would invoke "design?" Now of course, here's where things get really ironic. He claims that atheists therefore rely on the morals of people of the past who where moral, and can't look to the future to guide them. This coming from a man who follows the teachings of a potentially fictional man that died nearly 2000 years ago, and who said we should follow the teachings of a bronze age text written thousands of years before that? I honestly don't even know how to answer that its so stupid, so I summarize my answer for his actual question: My morals are based on a scientific world view, which help guide me to do what is best and most helpful to humankind.

  4. (5:22) How did morals evolve? - This is really just a rehash of the last question, and I've already answered it, so on to the last mind-numbing question, or it may be the aspirins that are numbing my mind right now, I can't tell.

  5. (6:19): Can nature generate complex organisms, in the sense of originating it, when previously there was none? - Most definitely yes, and it is done through a process called natural selection. I have to say, I'm glad I just did a post on simulating natural selection, as it itself is a pretty good answer to this question.

Wow, these aspirins are making me dizzy. I think my next blog will be from rehab, although I'm not sure if the rehab is for non-prescription drug abuse, or the massive loss of brain cells from watching such a mind-numbingly stupid video.

  1. Universe. (August 27th, 200). In Wikipedia, The Free Encyclopedia. Retrieved August 28th, 2008 from http://en.wikipedia.org/wiki/Universe
  2. Dawkins, Richard. (2006) The Selfish Gene, 30th anniversary edition. Oxford University Press. ISBN 978-0-19-929115-1

Monday, August 25, 2008

Simulating Natural Selection

Needless to say, but this post has been a long time coming. Shortly after my last post, I started working on a computer program that would simulate natural selection using organisms whose properties where based on its genome as opposed to simply programmed properties. Also, I wanted to make sure that the selection process on the organisms where as close to pure natural selection as possible, while staying away from artificial selection. In other words, I wanted to defining factor to be based on reproductive success, as opposed to a pre-programmed goal (such as fastest runner, etc.).

At first, the programming was going great, I had spent quite a few months working on it, and I had a working program and was beginning to compile samples and results. That's when everything went to hell. A seemingly insignificant crack on the side of my laptop eventually split the screen from the main body of laptop, which broke the cord between the screen and the main body, and sent a short circuit to the hard drive, destroying all the information contained. Not only did I loose the program, I also lost almost a years work in other programs, and 3D models (for a space station I was building with Orbiter).

Needless to say, loosing months and months of data, programs, and 3D models rather killed my enthusiasm. Eventually however, I did get back to re-creating the program. The first incarnation was made mostly at my work while I worked on the night shift, and one of my colleagues would always ask my if I was "playing with my dots" (the organisms in the program are represented by little squares). So when I started my new program, I decided to officially name it DOTS (DNA Over Time Simulator). It's not entirely the most accurate title, namely that the program also simulates RNA as well as DNA, in fact, when the program was first written, it only simulated RNA.

Introduction

Genes

Alanine/A

GCT, GCC, GCA, GCG

Leucine/L

TTA, TTG, CTT, CTC, CTA, CTG

Arginine/R

CGT, CGC, CGA, CGG, AGA, AGG

Lysine/K

AAA, AAG

Asparagine/N

AAT, AAC

Methionine/M

ATG

Aspartic acid/D

GAT, GAC

Phenylalanine/F

TTT, TTC

Cysteine/C

TGT, TGC

Proline/P

CCT, CCC, CCA, CCG

Glutamine/Q

CAA, CAG

Serine/S

TCT, TCC, TCA, TCG, AGT, AGC

Glutamic acid/E

GAA, GAG

Threonine/T

ACT, ACC, ACA, ACG

Glycine/G

GGT, GGC, GGA, GGG

Tryptophan/W

TGG

Histidine/H

CAT, CAC

Tyrosine/Y

TAT, TAC

Isoleucine/I

ATT, ATC, ATA

Valine/V

GTT, GTC, GTA, GTG

START/M

ATG

STOP/*

TAG, TGA, TAA

When the program is started, a list of genes is created. The code used for the genes is the same as used in all eukaryotic organisms[1]. RNA organisms in the program all use the same code, the only difference is that the nucleotide for Thymine (T) is written as a Uracil (U) instead, however this has no major effect on the coding itself. All genes are composed of an amino acid for Methionine (the start codon), and a stop marker. An example of a gene would be "MDDTWRKPRstop".

However since many of these amino acids can be expressed in different ways, there are many different strings of nucleotides that can code for those amino acids, for example:

M D D T W R K P R *
ATG GAC GAC ACA TGG AGG AAG CCG CGT TGA
ATG GAC GAT ACC TGG AGG AAG CCA CGA TAA
ATG GAT GAC ACT TGG CGC AAA CCT CGC TAG

Each gene that an organism has subtracts energy from the organism, based on the length of the gene. The longer the gene, the more energy it uses. At present, there are 9 different types of genes programmed. If a gene appears in an organism that doesn't appear as any of the functional gene lists, it will still subtract energy while providing no other effect on the organism, and is labeled as a Pseudogene. The different functional types of genes are:

Herbivore Genes: These extract energy from the environment. The amount of energy available to each organism is based on a number of factors. Firstly, is the maximum amount of energy the herbivore gene can extract. Secondly, the amount of surrounding squares that are unoccupied. Only squares that have no organisms (other then its own) can provide energy, so the more open squares, the more energy available. Conversely, the fewer organisms that surround each of those open squares allows for the open square to provide more energy itself. Lastly, there is a maximum amount of energy that each square can provide. For example, if the maximum amount available is set to 500, and the gene's maximum available energy was 700 (or the total of all the herbivore genes), then even if every square was open, and every square around those were open, then the organism could still only extract 500 from the environment.

Asexual Reproduction Genes: These allow an organism to reproduce independently of a mate, and are the most basic (and currently only) form of reproduction creating a clone of the parent organism. The more Asexual Reproduction Genes an organism has, the more offspring it can produce at a time (for example, if it has 3 genes, then it can produce 3 offspring at a time, assuming that many open squares are available). If an organism lacks an Asexual Reproduction Gene, then it will be sterile, and unable to reproduce.

Attack Genes: If there are other organisms surrounding the organism with an attack gene, it will randomly select one and try to kill it. Each Attack Gene that an organism has, adds one attack point to it.

Defense Genes: Each defense genes that an organism has, adds one defense point to it.

Carnivore Genes: These genes allow an organism to extract energy from any other organisms that it kills. The amount of energy extracted from a kill is based on the length of the prey's genome, and the efficiency of the gene. The more efficient the gene, or the longer the prey's genome, the more energy extracted. The amount available also depends on if the organism it is consuming is a herbivore (full efficiency), and omnivore (half efficiency), or another carnivore (fifth efficiency). If an organism has more then one carnivore gene, then the organism's total carnivore efficiency is an average of the genes efficiency.

Altruistic Genes: Organisms that contain one of these genes are stopped from attacking other organisms of the same species. Whether or not an organism is deemed as the same species, is based on how similar its genomes are. For example, if an organism shared 95% of its DNA in common with its prey, and its Altruistic Gene was set at 6%, then it would consider it the same species and would not attack. However, if the same organism had an Altruistic Gene set at just 4%, then it would deem the prey as another species, and continue its attack.

Transcription Error Protection Genes (TEP Genes): These genes control the amount of error during transcription when an organism reproduces. It a TEP Gene has a value of 1%, then there is a 1% chance every time a nucleotide is transcribed during reproduction, that a nucleotide will be duplicated, skipped, or changed. If an organism lacks a TEP Gene, then the chances of error sky-rocket, rendering it almost infertile, as any offspring of its will likely lack any functioning genes due to widespread error. If an organism contains multiple TEP genes, then the organism's Transcription Error will be an average of its TEP genes.

Offspring Energy Transfer Genes (OEP Genes): Organisms containing this gene, pass on a percentage of its energy to its offspring when it reproduces. The percentage of its energy that it passes on differs between each OEP Gene, and if an organism has more then one, then it averages the percentages between the genes.

Movement Genes: These genes give an organism the ability to move to an adjacent square. In herbivores, it will move the organism to the most open square available, in carnivores it moves it to an open square that is adjacent to other organisms. The more Movement Genes an organism has, the less energy is needed during movement.

Genes do not have to match the genes in the lists 100%. Genes that match only partially (down to a certain percentage, the default is a minimum 60% match), work with reduced effectiveness. In Herbivore Genes for example, a partially match reduces the amount of herbivore energy that the gene can extract from the environment. For Carnivore Genes, it reduces the genes carnivore efficiency. Another effect of a gene needing to be only partially matched is that a gene may match (or partially match) many different genes, and therefore a single gene may take on multiple abilities.

Below is an example of an organism and the genes it contains. It contains 1474 nucleotides (or 737 base pairs) contains both partial genes, a short pseudogene, and was born after 2442 turns:

TTAGGGAAAAAAACCCCGGGATAACCAGGTCCAAAAGACTTTTTTCCCTC AATCCCTTTTTTTGGGGCCCTATTGGTCCAGGTTTTCTGAAAAAAGGGAG

CAAACTATTTCACTCCCTCCATTTTAGGGTATTTTTTGGGGGACGCCTCA GTTTGATAAAGTGAGGGAGGTAAAATCCCATAAAAAACCCCCTGCGGAGT

AACAAGGGGAAGTGGAGCCCCGGAGGATACCCGCCCTCAGTGGAAAGCAT TTGTTCCCCTTCACCTCGGGGCCTCCTATGGGCGGGAGTCACCTTTCGTA

GCATTTTTTTCACTAGCCGGTCCTGGTGGGCAACGAAAAACCGAGCTTGG CGTAAAAAAAGTGATCGGCCAGGACCACCCGTTGCTTTTTGGCTCGAACC

CTAAACCGGACAATAACTTCCGCGGGTTTTGGGGCTCCCCCAAAGGTGCC GATTTGGCCTGTTATTGAAGGCGCCCAAAACCCCGAGGGGGTTTCCACGG

GAGGGGATTTTGGGGCGGCGAAAAAGAGTTTCGCCGTAGAACCCCCAAGG CTCCCCTAAAACCCCGCCGCTTTTTCTCAAAGCGGCATCTTGGGGGTTCC

GAGGCGCAAGGGCCAATTTCACGGGAGGTATAGGTTCACTTCCATAGACA CTCCGCGTTCCCGGTTAAAGTGCCCTCCATATCCAAGTGAAGGTATCTGT

CATAAACGTTTTCCCAAGTACCCCCTAAAGGGCCTCCAAAGAAAGGGGGA GTATTTGCAAAAGGGTTCATGGGGGATTTCCCGGAGGTTTCTTTCCCCCT

AGCTCCCGTAAAAAACAAAACGTTGGTCGGGGGGGTCTTTTTGAGGGGGA TCGAGGGCATTTTTTGTTTTGCAACCAGCCCCCCCAGAAAAACTCCCCCT

GCCGGGTCCGGTGGTAGTCCTAAGGTGATAGGGATTTGTTGGCGGGGTGG CGGCCCAGGCCACCATCAGGATTCCACTATCCCTAAACAACCGCCCCACC

TTTTTCTGCTATTAAAACAAATTTTTTACTCCATTGGGCGCGCCCCAGCC AAAAAGACGATAATTTTGTTTAAAAAATGAGGTAACCCGCGCGGGGTCGG

GTTGTTTCCTCGCCCAATGTTTGCGGTTCCTTAACCCCAGTGGTCGTAAC CAACAAAGGAGCGGGTTACAAACGCCAAGGAATTGGGGTCACCAGCATTG

CCCCGCTTCGGGGCGCAGCCCTTCCGAAACCACCAACCAAAGCTTTAATA GGGGCGAAGCCCCGCGTCGGGAAGGCTTTGGTGGTTGGTTTCGAAATTAT

GCTCGAATCACAGTTTCCCTTTGGGGGGGCGGGGGGGCCCCAGGGTAAGA CGAGCTTAGTGTCAAAGGGAAACCCCCCCGCCCCCCCGGGGTCCCATTCT

AAACGGGGGGGGAAGCCCCTGTCCGGACAAAACTGTA TTTGCCCCCCCCTTCGGGGACAGGCCTGTTTTGACAT

The genes contained in the organism are:

Herbivore Gene 1 100% M H F F H *

ATGCATTTTTTTCACTAG

Herbivore Gene 13 80% M F A V P *

ATGTTTGCGGTTCCTTAA

Pseudogene M E *

ATGGAGTAA

TEP Gene 1 100% M C L W K *

ATGTGTCTATGGAAGTGA

Herbivore Gene 1 80% + Asexual Reproduction Gene 1 60% M H A F H *

ATGCATGCTTTCCACTGA

Herbivore Gene 13 60% + Asexual Reproduction Gene 26 80% M E G V K *

ATGGAGGGAGTGAAATAG

Organisms

After the list of genes are created, the program then creates the organisms. It starts with a creating a genome for a master organism, and then duplicates it across the grid. The grid the organisms live on consists of 50 rows and 100 columns, totaling 5000 squares. The starting genome consists of a Herbivore Gene, TEP Gene, an Asexual Reproduction Gene, and "junk DNA" spread out between and around the genes randomly. When the junk DNA is made, the letters "ATG" and "CAT" (the reverse synonym for ATG) are prevented from appearing so as no pseudogenes appear that would interfere with the starting three 3 genes, however if one of the working genes contain CAT in it, then a pseudogene will appear on the opposite side of the gene. The 3 active genes can appear in any order, and on other the 5' (5 prime, read left-to-right) or 3' (3 prime, read right-to-left) side of the genome. Below is an example of a first generation organism, it contains 1308 nucleotides (654 base pairs) and is the ancestor of the organism shown above:

ATTTAGAGCGAACCGTGCGGCCGCTATTGATCAAGTTTCTGCTAACAGCG TAAATCTCGCTTGGCACGCCGGCGATAACTAGTTCAAAGACGATTGTCGC

AACTAAATCAGTTGACCTCTACAACCGGAACAGCCGAAGGAAGGAGGTGC TTGATTTAGTCAACTGGAGATGTTGGCCTTGTCGGCTTCCTTCCTCCACG

TTCTTTGCCGACTCAGTCGAAACGAATGCATTTCTTTCACTGAGTCTATC AAGAAACGGCTGAGTCAGCTTTGCTTACGTAAAGAAAGTGACTCAGATAG

CTCTCAAGAAAGAACGAAGCACACTCGGCGTACTGACAGCAGGCAACAGG GAGAGTTCTTTCTTGCTTCGTGTGAGCCGCATGACTGTCGTCCGTTGTCC

CACTCCCCAAAAGTAGGGGTTGACACTGTGAGGAATAACTGCCTTGGCTC GTGAGGGGTTTTCATCCCCAACTGTGACACTCCTTATTGACGGAACCGAG

GGTTAGACGACGCAACCCCAAAAAGTGCCCAATTTAGATTACTTCCATAG CCAATCTGCTGCGTTGGGGTTTTTCACGGGTTAAATCTAATGAAGGTATC

ACACATAAGAACCCGGAATTAGTCTCTTCCTAGGAAAAGGTCTATTTGTA TGTGTATTCTTGGGCCTTAATCAGAGAAGGATCCTTTTCCAGATAAACAT

TTAGATCAACTAGAGTTGCAGAGGCTCAGTCGCGAAACGCTCAGGGAGTC AATCTAGTTGATCTCAACGTCTCCGAGTCAGCGCTTTGCGAGTCCCTCAG

AGACTACAATACGTTATCTGTTGTAGAGCTTTTGTAATACCGTTGGTACC TCTGATGTTATGCAATAGACAACATCTCGAAAACATTATGGCAACCATGG

ACAAGTTCGGCTGTGCGCGTCGAGGAATCAAATGAGCGCGTTTGCTTGAC TGTTCAAGCCGACACGCGCAGCTCCTTAGTTTACTCGCGCAAACGAACTG

GGGCACAGTAAACTTCCCACCCAATAGAGAAGGTGATATCTAGCGACCTA CCCGTGTCATTTGAAGGGTGGGTTATCTCTTCCACTATAGATCGCTGGAT

ATCAGCCACGTCCGATCCACGTACGTGGCGTCCTCGCGTTCGCCAGTCTT TAGTCGGTGCAGGCTAGGTGCATGCACCGCAGGAGCGCAAGCGGTCAGAA

AGTGTTAAGAGAGAGTCAAGAAGTAAGTGCCTGCGACGGATATTCCGCCA TCACAATTCTCTCTCAGTTCTTCATTCACGGACGCTGCCTATAAGGCGGT

ATAG TATC

The genes contained in the organism are:

Herbivore Gene 100% M H F F H *

ATGCATTTCTTTCACTGA

Asexual Reproduction Gene 100% M S A F A *

ATGAGCGCGTTTGCTTGA

TEP Gene 1 100% M C L W K *

ATGTGTCTATGGAAGTAA

Pseudogene M H S F R L S R Q R S T S F L R L F R L *

ATGCATTCGTTTCGACTGAGTCGGCAAAGAAGCACCTCCTTCCTTCGGCTGTTCCGGTTGTAG

Virtually all of the organisms features and properties are encoded by its genome and the genes therein. The only properties that are coded separately are the organisms Life Expectancy (when it dies of old age), and its Age of Maturity (the age it can begin to reproduce). Each of these provide various advantages and disadvantages. The later the Life Expectancy, the more chances an organism will be able to reproduce, but the more energy the organism will need to reproduce. The earlier an organism matures, the sooner it can reproduce, however the later it matures, its attack points, defense points, and OET efficiency goes up.

Asexual Reproduction

When an organism reproduces, it transcribes the nucleotides of the 5' strand, and then mirrors it for the 3' side. Every time a transcription is made, there is a chance (as dictated by the organism's TEP genes) for error. The nucleotide may be altered, omitted, or be copied twice. Each type of error has an equal chance of occurring. Life Expectancy and Age of Maturity also can change during reproduction. Life Expectancy and Age of Maturity, separately, can either increase, decrease, or stay the same with equal chance of each happening. Below are the first 50 nucleotides of the 5' side of a first generation organism, and three 2nd generation offspring.

First Generation CACTATCCTCAGCTAACGATCCCACTATACTCTCACCAAGATTTTTAAGG
9th point substitution CACTATCCACAGCTAACGATCCCACTATACTCTCACCAAGATTTTTAAGG
29th point deletion CACTATCCTCAGCTAACGATCCCACTATCTCTCACCAAGATTTTTAAGGA
37th point duplication CACTATCCTCAGCTAACGATCCCACTATACTCTCACCCAAGATTTTTAAG

Combat

If an organism contains at least 1 attack gene, it may attack an organism in an adjacent square (either horizontally, vertically or diagonally). In the program, the organism attacking is known as the predator, and the organism being attacked becomes the prey. If the prey has attack genes of its own, then the organisms attack properties are matched up against each other. If one organism's attack points are higher then the other, it does not guarantee victory. Each organisms attack points are multiplied by separate random numbers. Therefore a predator with an attack point value of 2 attacking a prey with an attack point value of 1 will be twice as likely to win, but not automatically guaranteed.

After the initial attack phase, comes an attack/defense phase. If the prey wins the attack phase of combat, then the roles in the attack/defense phase are reversed. The predator's attack points come up against the prey's defense points in the same style as the attack phase. The predator's attack points are multiplied by a random number, and the prey's defense points are multiplied by a separate random number, with the higher number winning. If the predator wins, then the prey is killed (and consumed if the predator is a carnivore/omnivore). If the predator loses, and the prey's defense is successful, then both sides survive. Both attacking and defending consume energy. If an organism's energy falls below zero as a result of the combat, then the organism dies.

Results

Speciation

-output7.dfx

-output9.dfx

As the adjacent graph shows, that despite the fact that the scenario begins with just a single species, diversity increases rapidly and then fluctuates between 30 and 35 percent (with default TEP Genes set at 1%). The drop at the end is the result of a new gene evolving that incorporated an Attack Gene, a Asexual Reproduction Gene, and an Altruistic Gene, along with a slightly more efficient TEP Gene. This drop is typical when an organism evolves that has significant advantages over other organisms, and quickly replace the organisms without the advantage.

In scenarios where a TEP gene emerges that is more effective then the starting one, diversity drops as the organisms containing the more efficient TEP gene quickly replaces those without (since their offspring are more likely to survive). Once they become the dominate group, new species take longer to evolve (due to less mutations each generation), those keeping the diversity down. For example, the scenario in output9.dfx, the organisms don't even reach 20% before a more efficient TEP Gene emerges. The average chance of transcription error drops down to 0.236%, however since this includes organisms lacking a TEP Gene (therefore having a transcription error of 20%), the actual efficiency of the TEP Gene is even higher then that (error rate of about 0.025%). The error protection of the gene is so powerful, that once the organisms with the gene takeover, the genetic diversity drops down to 0% (all organisms are the same species). Evolution still occurs, however the rate of change becomes very slow, and diversity remains low.

Emergent Behavior and Phenomena

Along with the reproduction behaviors and combat behaviors programmed into the organisms by their genes, their are a few "emergent" behaviors that appear that result from the interactions between organisms, that are not coded in.

Base-pair Repetition: After a number of generations, it becomes apparent that many base-pair sequences begin to repeat themselves. In the two example organisms above, the first generation organism contains a total of 27 repetitions greater then 3, the longest of which was a sequence that lasted 5 spaces, and 6 sequences lasting 4 squares. While the organism from Turn #2442 contains a total of 85 repetitions greater then 3, the longest sequence lasting 8 spaces. The purpose of the repetitions seems to work as a safeguard against the formation of unwanted pseudogenes by stopping the formation of ATG sites. Due to the repetitions, potential sites for an ATG codons to appear (doublets of "AT" or "TG") decrease. If the first generation organism there are 103 possible sites for a single-point mutation to create an ATG codon, whereas the 2442 Turn organism contains just 85 sites, despite being 13% longer then the first generation organism.

-World of organisms containing movement genes

-World of organisms lacking movement genes

Pack/Anti-Pack Formation: To the right is two screenshots of organisms after about 150 turns. In the top screenshot, the world started out with organisms containing Movement Genes. In the bottom screenshot, the organisms started without them. In the world populated by organisms containing Movement genes, the organisms spread out, forming a checkerboard pattern, however when they can no longer spread out, they begin to form into columns and files, forming patterns similar to that of coral. The emergent behavior is due simply to each organism looking to find the most open space possible. When there is enough space for each organism to have completely open adjacent squares, they form the checkerboard pattern, otherwise, they form the coral shape pattern.

In scenarios where the organisms lack movement genes, the organisms do not spread out, and simple stay near other members of there species, former scattered clumps of organisms. When the clumps become too big and the organisms in the center can no longer provide energy for themselves (or can no longer reproduce), they die off and the clumps break apart into smaller clumps.

Multiple Partial Genes: Along with base-pair repetition, another emergent property in the DNA of the organisms is the tendency for genes to evolve to make multiple partial matches, as opposed to a single 100% match. This is caused by the fact it is easier to modify existing genes then it is to create new ones. Below is an example of an omnivore that evolved after 1102 turns, and contains 665 base-pairs (1330 nucleotides), where most of its functioning genes have evolved towards incorporating multiple gene types as opposed to evolving genes that match 100%. The long Pseudogene at the end of the 3' side does not actually contain a stop codon, instead stopping only because it has hit the end of the genome:

AGGTCCGGTCTAAATTAACTTTTTTCCTACCCCTTATTAAGGAAAAACCC TCCAGGCCAGATTTAATTGAAAAAAGGATGGGGAATAATTCCTTTTTGGG

CTCCCCAAGGAGGTGGCCTTATTAATCGGGGGGCTGTACATTTTACAAAT GAGGGGTTCCTCCACCGGAATAATTAGCCCCCCGACATGTAAAATGTTTA

AATAAAAAAACCCGTGTGCATGGAACCCTTAACTTAAAGTGTTCCGGAAA TTATTTTTTTGGGCACACGTACCTTGGGAATTGAATTTCACAAGGCCTTT

AGCGGCTGAAGCTATTATATACCTTCAGGAGCCTCGAATAAATCTTAACT TCGCCGACTTCGATAATATATGGAAGTCCTCGGAGCTTATTTAGAATTGA

GTTGGAGGTTTCTACGGAAAGAAATCAGCCGTTTGTATTCAAATACGTAT CAACCTCCAAAGATGCCTTTCTTTAGTCGGCAAACATAAGTTTATGCATA

TTTAAATGCTTTACTAGAAGAAACCACGGGGCCGAAACGCGCCCTTTTTT AAATTTACGAAATGATCTTCTTTGGTGCCCCGGCTTTGCGCGGGAAAAAA

AACGATGCGGAGAGCTCGCTAGAAAAATGCAGAAGAGGGCTTAAGCCGGA TTGCTACGCCTCTCGAGCGATCTTTTTACGTCTTCTCCCGAATTCGGCCT

AAATAGACGGCTGAAACGGCTCGGAAGTCTTATAGGTTTCAACTCTACTG TTTATCTGCCGACTTTGCCGAGCCTTCAGAATATCCAAAGTTGAGATGAC

GAGCAGAGCCACTCCCCCGAGGTATAAAAGTTTCTTGAAAGACCACCCTG CTCGTCTCGGTGAGGGGGCTCCATATTTTCAAAGAACTTTCTGGTGGGAC

TTCACCGAAGTCTGGGTTACAAGTTTATATCTTAATGCCTTGTCCGCAGT AAGTGGCTTCAGACCCAATGTTCAAATATAGAATTACGGAACAGGCGTCA

AGGGCTTTACACACAAACGGTAAACAGCGGGAATTAAAATTACCCCCCCG TCCCGAAATGTGTGTTTGCCATTTGTCGCCCTTAATTTTAATGGGGGGGC

GAAAAAATTTTTATTGGGACCCCCTTCAGACGGCGGCTACGTTTTTCTTT CTTTTTTAAAAATAACCCTGGGGGAAGTCTGCCGCCGATGCAAAAAGAAA

TGGTTAAAACGGCTTAGAGTACAAATCGCCTTTTGGCGAAAGCAGGACCC ACCAATTTTGCCGAATCTCATGTTTAGCGGAAAACCGCTTTCGTCCTGGG

GTAAAACCCCTGTTA CATTTTGGGGACAAT

The genes contained in the organism are:

Herbivore Gene 33 60% M E P L T *

ATGGAACCCTTAACTTAA

Pseudogene M L Y *

ATGCTTTACTAG

Herbivore Gene 37 60% + Carnivore Gene 1 60% + Asexual Reproduction Gene 1 60% M R R A R *

ATGCGGAGAGCTCGCTAG

Attack Gene 5 60% + Asexual Reproduction Gene 42 60% M Q K R A *

ATGCAGAAGAGGGCTTAA

Herbivore Gene 1 80% + Herbivore Gene 15 60% + TEP Gene 16 60% M P C P Q *

ATGCCTTGTCCGCAGTAG

Pseudogene M H T G F F I I C K M Y S P P I

ATGCACACGGGTTTTTTTATTATTTGTAAAATGTACAGCCCCCCGATT

N K A T S L G R G F S L I R G R

AATAAGGCCACCTCCTTGGGGAGGGGTTTTTCCTTAATAAGGGGTAGG

K K V N L D R T *

AAAAAAGTTAATTTAGACCGGACCT

-output6.dfx

-Omnivore "explosion"

Carnivore Rise and Falls: In early simulations when the program lacked an Age of Maturity (and thus could immediately reproduce), the scenarios often went through two major stages of development (see output2.dfx and output3.dfx). In the first stage, the world was dominated by herbivores. Once the herbivores evolved to a point where they couldn't extract any more energy from the environment and became densely populated, omnivores (and to a lesser degree carnivores) evolved and quickly took over. Carnivores and omnivores did emerge before this, however the population wasn't dense enough for them to take over. One of the immediate effects of the omnivores was a massive drop in the average age of the population from about half the average maximum age, to just over 1.5 turns, and the average life expectancy dropping as well (in output3.dfx in settled to an average of about 5 turns).

After an Age of Maturity was introduced, the sudden onset of carnivores either happened much later, or not at all (the more common occurrence). However, even when omnivores/carnivores never took over, omnivores/carnivores often still appeared when the world became densely populated. However instead of a world dominated by omnivores forming, the carnivores would consume all the local organisms close to them, followed by their offspring doing the same, until the "explosion" of omnivores or carnivores expanded too far, and then would either die off from consuming all the local organisms or from killing each other. However once the herbivores had repopulated to area, any surviving omnivores (or any newly evolved ones) would repeat the cycle. In cases where the carnivores or omnivores contain altruistic genes, the omnivores would be able to spread out even farther without collapse, and even balance out with the herbivores. The omnivore/carnivore "explosions" can be seen in the data by short term rising and falling of omnivores and carnivores in the data.

Genome Length

- output5.dfx

- Genome composition by percent (output6.dfx)

In all but 1 output, there was a general increase in genome length over time, with the organisms at the end having longer genomes then the starting organisms (output1.dfx showed an increase of over 350 nucleotides). However, a longer genome is not always better. In many cases a shorter genome can be better. While shorter genomes seem to be more prone to the appearance of harmful pseudogenes (due to fewer repeating sequences), they are therefore also more likely to evolve new beneficial genes. This is exemplified the most by output4.dfx, that decreased by approximately 150 nucleotides over the span of its run. Decreases in genome length typically seem to occur during periods of large-scale change (such as the emergence of wide-spread carnivores in output2.dfx and output3.dfx), forming a pattern of long-term lengthening, interspaced with short periods of shortening.

Also, along with longer genome lengths, there is a general increase in the percent of useful information over time as the organisms evolve to use more of their "junk" DNA. Also, most simulations also show a decrease in the amount of pseudogene information in the organisms, in both amount and percent.

Future Development

Save Function: An ability to stop a simulation, save it, and re-open it later. This would allow for much longer simulation runs.

Multiple Environments: At current, the "world" consists of a single environment. An organism that can survive on one square, can survive on any other square. Multiple environments, such as a temperature gradient, or land/water areas may change the way creatures evolve, and create different niches for organisms to survive and evolve in, more similar to what is seen in reality.

New Genes: Along with new environments, new genes to allow organisms to survive in them, such as a gene for breathing in water, and another for breathing on land, or genes for surviving in different temperature zones. Also, a gene for eating decaying material, so when an organism dies (and is not consumed by a carnivore), it decays over time, and any organisms with a "scavenger" gene may consume the decaying material. New parenting genes, such as ones for herbivores to pass on energy to its offspring (similar to an OET gene, but continue to do so until the offspring has matured), or genes for organisms with attack genes to come to the defense of other members of its species.

Chromosomes: Along with the basic DNA structure currently modeled, have the ability of the organisms to evolve chromosomes. These chromosomes would have basic telomeres at the ends, and a centromere in the middle, similar in chromosomes in eukaryotes. Chromosomes would allow for newer types of error such as trisomy, etc.

Sexual Reproduction: Along with asexual reproduction, organisms containing chromosomes could also evolve sexual reproduction, mating with other members of its species, and have their offspring be a combination of their chromosomes.

Using Genes to Control Age: Instead of using a separate variable, outside of the organisms genome, to control lifespan and age of maturity, use genes to control them instead. Instead of having a pre-determined maximum age, have each organism need more energy as it gets older, and have a genes to control the rate of energy-requirement increase. Transcription error could also be reprogrammed to change with age, and have a greater chance of transcription error as the organism gets older. Similar with Age of Maturity, make the energy required to reproduce drop with age, and have the rate of drop be controlled by genes.

References

  1. Elzanowski, Andrzej (Anjay), and Ostell, Jim. The Genetic Codes. (December 4th, 2007) In National Center for Biotechnology Information. Retrieved August 20th, 2008 from http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi

Raw Data

  • Zip File containing the output.dfx files (tab-delimited file, can be read using notepad, or imported/pasted into Microsoft Excel).

Thursday, July 12, 2007

The Conflicting Genealogies of Jesus

    In the New Testament, there are two conflicting genealogies given, one in the Gospel of Matthew, and the other in the Gospel of Luke.  Now, this is obviously a problem for Christian apologists/literalists who claim that the bible is perfect, and doesn't contradict itself.  The most common explanation given is that the one belonging to the Gospel of Matthew describes the genealogy through Joseph (Jesus' father), and the one in the Gospel of Luke is the genealogy through Mary.  The are a few other possibilities that people give[1], but this is by far this seems to be the most common.  This article is modified from a post I made responding to a theist who was trying to claim this.

The Two Genealogies of Jesus

Gospel of Matthew[i] - 1:1-16 Gospel of Luke - 3:23-38
  God
Adam
Seth
Enosh
Kenan
Mahalalel
Jared
Enoch
Methuselah
Lamech
Noah
Shem
Arphaxad
Cainan
Shelah
Eber
Peleg
Reu
Serug
Nahor
Terah
Abraham
Isaac
Jacob
Judah
Perez
Hezron

Ram

Admminadab
Nahshon

Salmon
Boaz
Obed
Jesse
Abraham
Isaac
Jacob
Judah
Perez
Hezron

Arni[ii]
Admin[ii]
Amminadab
Nahshon

Sala[iii]
Boaz
Obed
Jesse
David
Solomon
Rehoboam
Abijah
Asa
Jehoshaphat
Jehoram
-
-
-
Uzziah[iv]
Jotham
Ahaz
Hezekiah
Manasseh
Amon
Josiah
-
Jeconiah


Shealtiel
Zerubbabel
Abiud
Eliakim
Azor
Zadok
Akim
Eliud
Eleazar
Matthan
Jacob









Joseph
Jesus
David
Nathan
Mattatha
Menna
Melea
Eliakim
Jonam
Joseph
Judah
Simeon
Levi
Matthat
Jorim
Eliezer
Joshua[v]
Er
Elmadam
Cosam
Addi
Melki
Neri
Shealtiel
Zerubbabel
Rhesa
Joanan
Joda
Josek
Semein
Mattathias
Maath
Naggai
Esli
Nahum
Amos
Mattathias
Joseph
Jannai
Melki
Levi
Matthat
Heli
Joseph
Jesus
  1. I've included a dash where the genealogy in 1 Chronicles 3:5-19 indicates there should be a name.
  2. Newer manuscripts omit these two names, and replace it with Ram.  There are also many other variations as well between different texts.  It appears that the text was redacted later to match Matthew (the earliest manuscript with the redaction to Ram is from the 6th century).
  3. Another redaction (earliest manuscript with the redaction is from the 5th century) done to correct it to Salmon.
  4. Azariah in 1 Chronicles 3:12
  5. Literally Jesu (`Ιησού), which is simply another from of Jesus.  This doesn't have anything to do with the argument, its just an interesting point.

    The apologists often make a number of arguments to support their claim:

  1. Women were considered inferior to men, so a genealogy through a mother would have to be represented through the father instead,
  2. An prophetic curse giving in Jeremiah 36:30 "Therefore, this is what the LORD says about Jehoiakim king of Judah: He will have no one to sit on the throne of David" and that Jesus had to have a second genealogy,
  3. Mary is mentioned very often in the first three chapters of Luke, and thus the genealogy would be from her, and
  4. That the line "He was the son, so it was thought, of Joseph"[2] in the Gospel of Luke's genealogy indicates that the author meant someone other then Joseph (i.e. Mary).

    The first problem with their argument, is the one about a mother's genealogy is represented through the father.  This is a bald face lie, and simply isn't true.  I have never seen another example of that ever, in or out of the bible (and indeed no one else has either, since it was never done like that).  Indeed, the author of Luke even briefly mentions Elizabeth's (Mary's cousin) origins without any problem[3].  While it is customary to include the father along with the mother (usually as "the husband of"), it was certainly not customary to replace the mother's name with the father's.

    In the table to the left, I've bolded the names where the gospels match each other.  Lets start with looking at the names Shealtiel and Zerubbabel, the two names in the middle of the Gospel of Matthew's and the Gospel of Luke's genealogies, between David and Joseph, that match.  The significance of these names is that these are descendants of David that came back to Israel after the Babylonian exile, and are mentioned throughout the old testament (Ezra, Nehemiah, etc).  Up to this point in the Gospel of Matthew, his genealogy mostly matches up with the one in given in 1 Chronicles 3:5-19 (the only place where this is given).  However a number of names are missing in Matthew's from that genealogy (Ahaziah, Joash, and Amaziah between Jehoram and Uzziah, and Jehoiakim between Josiah and Jeconiah).  The likely reason for this is because he wanted 14 generations in between each major generation/event (David, the exile in Babylon, and Jesus) as stated in Matthew 1:17.  In the Gospel of Luke on the other hand, it seems is completely made up, as the genealogy the author gives doesn't appear anywhere in the old testament.

    So right away, we have a major problem with the apologetic argument.  In the standard argument, it is said that the genealogies split at David, with Joseph's lineage being followed through Solomon, and Mary's through Nathan's.  If that's so, then why the link up at Shealtiel and Zerubbabel?  Neither of these names were common, they appear in the right order, and they both appear in the middle of the genealogies between David and Joseph, meaning that they are almost certainly the same Shealtiel and Zerubbabel mentioned in Matthew, and throughout the old testament.  One could argue that the genealogies split here instead, but then you are stuck with two new problems.  First of all, your stuck trying to explain why the authors gave conflicting genealogies between David and Shealtiel, and secondly, the apologetic argument shoots itself in the foot now, since Mary would then also be a descendant of Jeconiah, and would thus inherit the same "prophetic curse."

    Another problem with the genealogy in Luke being from Mary is the large difference in the number of generations between the Gospel of Luke's account and the Gospel of Matthew's account.  In Matthew, there are 15 generations between David and Shealtiel , but in Luke, there are 21 generations.  Also, between Zerubbabel and Joseph, there is a large difference.  In Matthew, there are 10 generations, and in Luke, there are 19, almost twice as much!  For a time span this long, it isn't surprising to see one or maybe two differences in the number of generations (due to one line having offspring at a younger age then the other), but to see a difference like that would be absurd.  Some apologists have tried to argue that the Sheatiel and Zerubbabel in the Gospel of Luke are not the same as the ones mentioned in the Gospel of Matthew, and that the Gospel of Luke's Sheatiel and Zerubbabel were not the same ones involved in returning from exile in Babylon, but only named after them, and thus came three or four generations after[4].  Of course, this means now there is a ratio of only 6 or 7 generations to the Gospel of Luke's 19!  Utterly preposterous.

    So far, I've only talked about the actual genealogies given in the Gospels, and I haven't even talked about what the authors actually say.  Here's where things get real fun (for me anyways).  Here's where it connects the genealogy to Jesus in Matthew:

    "...and Jacob the father of Joseph, the husband of Mary, and Mary was the mother of Jesus who is called the Messiah." - Matthew 1:16, TNIV

    And in Luke:

    "He was the son, so it was thought, of Joseph, the son of Heli..." - Luke 3:24, TNIV

    In the beginning of the Gospel of Luke, Mary's name is mentioned a total of 15 times, however, not a single one of these occurrences has anything to do with genealogy.  Every single reference is part of the Gospel of Luke's telling of Jesus' birth and childhood (and often it is "Joseph and Mary").  Not only that, every single one of them is in the first two chapters, chapter 3 (the one that contains the genealogy, which is given after his baptism, and when Jesus was about thirty) doesn't contain a single reference to Mary (by name, or any other way).  Saying that her name appears often in the first three chapters is a gross misrepresentation of the facts.  Indeed, these 15 references in the first two chapters are the ONLY references to Mary, in the entire of Gospel of Luke (unless you include Luke 11:27 were some random lady in a crowd shouts out "Blessed is the mother who gave you birth and nursed you.").  Overall, the author of Luke doesn't seem very concerned with Mary, other then to pump out Jesus during the nativity story (which the genealogy isn't a part of).

    As the apologists seem think, the designation "supposedly" (or "so it was thought" in the translation here (from the TNIV)) from Luke 3:23 seems to signify some a genealogy from Mary from some how.  However you don't really say how it does, you just say it indicates that its saying Jesus wasn't the biological son of Joseph, and then jump to the claim that that must mean the genealogy here is from Mary.  Let's look at what the concerning part in Luke 3:23 says in the original Koine Greek:

    "ων υιος, ως ενομιζετο" (oon huios, hoos enomizeto)[5]

    "ων υιος" simply means "He was the son", but "ως ενομιζετο" is the interesting part.  ως is particle this is used to compare, and be translated as "as, like, as though, as if, on the grounds that, on the pretext of, etc."  ενομιζετο is the aorist (basically past tense, but not that simple) passive of the verb νομιζω (meaning "I suppose/consider"), so basically ενομιζετο means "He was supposed/considered."  I would basically translate the whole phrase as "He was the son, as he was considered" (which is pretty close to what most seem to translate, albeit mine is a bit more word for word).  So basically the author is making a disclaimer, the author is saying is that although he knows that Jesus isn't the physical son of Joseph, he was considered his son, so he is going to use Joseph in the genealogy.  The author of Matthew also seems to be doing something similar, by placing Mary in between Joseph and Jesus.

    So why the big difference between the gospels?  Most scholars agree that the Gospel of Matthew was written sometime late in the last two decades of the first century 1st century[6].  Also, most scholars seem to agree that the author of Matthew was a Jew himself (or was a Jew before becoming a Christian), and shows a great deal of knowledge of Judaism and the Tanakh (The Old Testament).  Subsequently, he knows of the genealogy of Shealtiel and Zerubbabel from 1 Chronicles 3:5-19, so he included it with some generations missing.  It seems most likely that the reason he took out four generations was so he could keep the number of generations even (14).  However, to get 14 in each group, you have to cheat a bit and count Jeconiah in both the line between David and the exile, and in the line between the exile and Jesus.  Whereas you don't count David twice.  It's also interesting to note that of the four people missing from his genealogy, one of them is Jehoiakim, the one who received the prophetic curse.

    The author of Luke on the other hand, doesn't seem to have the same level of knowledge of Jewish culture and the Tanakh, and probably was a Gentile before becoming a Christian.  Also, this gospel was written much later, and was probably written sometime in the early 2nd century.  This can be seen by the authors apparent use of the works of a late 1st century historian named Josephus Flavius[7], and the appearance of an early 2nd century Gnostic leader named Simon Magus (or Simon the Sorcerer as he is called) in Acts 8:9-24.  By this point, knowledge of the Tanakh may not have been as important to Christians as it was when the Gospel of Matthew was written, which would be especially true for a non-Jewish author.  As such, the author may have known about Shealtiel and Zerubbabel (who are mentioned many times in the Old Testament), but was unfamiliar with the genealogy that appears for them in 1 Chronicles 3:5-19.  As such, he had to create a genealogy between Nathan (who is mentioned as on of David's sons in other places such as 2 Samuel 5:14) and Shealtiel, as well as between Zerubbabel and Joseph.

    So put simply.  Each author of the two gospels wanted to create a full history of Jesus, since each author believed in a historical Jesus and wanted others to as well, but were stuck working with what they had.  Neither had a genealogy between Zerubbabel and Joseph, but the author of Matthew had a bit more knowledge of the Tanakh, so he was able to include more from the Tanakh, and didn't have to make up as much.  This leads to one undeniable conclusion about the authors of these two gospels (although plenty continue to deny it), and that is the fact that gospel writers had no problem making things up, and presenting them as fact, to try and convince people that Jesus existed.  And this, among many other reasons, is exactly why the gospels can not be trusted as a source for historical information.

  1. Genealogy of Jesus. (July 6th, 2007). In Wikipedia, The Free Encyclopedia. Retrieved July 12th, 2007 from http://en.wikipedia.org/wiki/Genealogy_of_Jesus
  2. Mass, A.J.  (1909).  Genealogy of Christ.  In The Catholic Encyclopedia, Volume VI [Electronic version].  New York: Robert Appleton Company.  Retrieved July 12th, 2007 from http://www.newadvent.org/cathen/06410a.htm
  3. Luke 1:5, TNIV
  4. Luke 3:23, TNIV
  5. Luke 3:23, United Bible Societies' Greek New Testament: 4th Edition
  6. Kirby, Peter. (2001). Gospel of Matthew. Retrieved July 9th, 2007 from http://www.earlychristianwritings.com/matthew.html
  7. Carrier, Richard. (2006) The Date of the Nativity in Luke (5th Edition). Retrieved July 12th, 2007 from http://www.infidels.org/library/modern/richard_carrier/quirinius.html